FAM130A1-family with sequence similarity 130, member A1 Gene View larger

FAM130A1-family with sequence similarity 130, member A1 Gene

PTXBC017221

New product

Data sheet of FAM130A1-family with sequence similarity 130, member A1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM130A1-family with sequence similarity 130, member A1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC017221
Product type: DNA & cDNA
Ncbi symbol: FAM130A1
Origin species: Human
Product name: FAM130A1-family with sequence similarity 130, member A1 Gene
Size: 2ug
Accessions: BC017221
Gene id: 81566
Gene description: family with sequence similarity 130, member A1
Synonyms: FAM130A1; C12orf2; C12orf22; PPP1R72; TAIP-12; cysteine/serine-rich nuclear protein 2; CSRNP-2; TGF-beta-induced apoptosis protein 12; family with sequence similarity 130, member A1; protein phosphatase 1, regulatory subunit 72; cysteine and serine rich nuclear protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgcattcacgggctcgggtctcaagaggaagtttgatgatgtggatgtgggctcatcagtttccaactcagatgatgagatctccagcagtgatagtgctgacagctgcgacagcctcaatcctcctaccactgccagcttcacacccacatccatcctgaagcggcagaagcagctgcggaggaagaatgtacgctttgaccaggtgactgtatactactttgcccggcgccaaggttttaccagtgtgcccagccagggtggtagctctctgggcatggcccagcgccataactctgtacggagctatacactctgtgagtttgcccaggaacaggaggtgaaccatcgagagattctgcgtgagcacctgaaggaagagaaactccatgccaagaaaatgaagctgaccaagaatgggacagtggagtcggtggaggctgatggcctgacgctggatgatgtgtcagatgaagatattgatgtggaaaatgtggaggtggatgattacttcttcctgcagcctctgcccaccaaacggcgacgggccctgctgagggcttctggggtccaccgtattgatgctgaagagaagcaagaacttcgagccatccgcctgtcacgggaagaatgtggttgtgactgccgactgtattgtgacccagaagcgtgtgcctgcagccaggctgggattaaatgccaggtggatcgcatgtcctttccatgtggctgctcccgggatggctgtgggaacatggcaggacgcattgaatttaatccaatccgggtccggactcattacctccacaccattatgaagctggagctggagagcaagcggcaggtgagccgcccagcagccccagatgaggagccctccccgactgccagttgcagcctgacaggagcacagggctctgagacccaggacttccaggagttcattgctgagaatgagacagcagtgatgcacctgcagagtgcagaggaactggagcggctcaaggcagaagaagattccagcggctctagtgccagcctggactcgagcatcgagagcctgggtgtgtgcatcctagaggagcctctggctgtccccgaagagctgtgcccaggccttacagcccccattctcatccaggctcagctgcccccaggctcctctgtcctgtgttttaccgagaactcagaccacccaactgcctcaacggtgaacagcccatcctacttgaacagtgggcccctggtctattatcaagtggagcagaggccagtcttgggagtgaaaggagagcctggtacggaagaaggctcagcctctttcccaaaggagaaggatctgaatgtcttctctctccctgttacctcactcgtggcttgtagctccacagacccagctgccctctgtaaatcagaggtggggaaaacacccaccctagaagctctattgcccgaagattgtaaccctgaggagcctgaaaatgaagacttccacccttcctggtccccctcaagcctccccttccgcacggacaatgaagagggctgtgggatggtgaagacctcccagcagaatgaggatcggccccctgaagattcttccttagaactccctctggcagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kelch repeat and BTB (POZ) domain containing 10
- 3'-phosphoadenosine 5'-phosphosulfate synthase 2
- valyl-tRNA synthetase 2, mitochondrial (putative)
- ubiquitin-conjugating enzyme E2Q family member 2

Buy FAM130A1-family with sequence similarity 130, member A1 Gene now

Add to cart