ENTPD3-ectonucleoside triphosphate diphosphohydrolase 3 Gene View larger

ENTPD3-ectonucleoside triphosphate diphosphohydrolase 3 Gene

PTXBC029869

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ENTPD3-ectonucleoside triphosphate diphosphohydrolase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ENTPD3-ectonucleoside triphosphate diphosphohydrolase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029869
Product type: DNA & cDNA
Ncbi symbol: ENTPD3
Origin species: Human
Product name: ENTPD3-ectonucleoside triphosphate diphosphohydrolase 3 Gene
Size: 2ug
Accessions: BC029869
Gene id: 956
Gene description: ectonucleoside triphosphate diphosphohydrolase 3
Synonyms: CD39L3; HB6; NTPDase-3; ectonucleoside triphosphate diphosphohydrolase 3; CD39 antigen-like 3; NTPDase 3; ecto-ATP diphosphohydrolase 3; ecto-ATPDase 3; ecto-ATPase 3; ecto-apyrase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcactgtgctgacccgccaaccatgtgagcaagcaggcctcaaggccctctaccgaactccaaccgtcattgccttggtggtcttgcttgtgagtattgtggtacttgtgagtatcactgtcatccagatccacaagcaagaggtcctccctccaggactgaagtatggtattgtgctggatgccgggtcttcaagaaccacagtctacgtgtatcaatggccagcagaaaaagagaataataccggagtggtcagtcaaaccttcaaatgtagtgtgaaaggctctggaatctccagctatggaaataacccccaagatgtccccagagcctttgaggagtgtatgcaaaaagtcaaggggcaggttccatcccacctccacggatccacccccattcacctgggagccacggctgggatgcgcttgctgaggttgcaaaatgaaacagcagctaatgaagtccttgaaagcatccaaagctacttcaagtcccagccctttgactttaggggtgctcaaatcatttctgggcaagaagaaggggtatatggatggattacagccaactatttaatgggaaatttcctggagaagaacctgtggcacatgtgggtgcacccgcatggagtggaaaccacgggtgccctggacttaggtggtgcctccacccaaatatccttcgtggcaggagagaagatggatctgaacaccagcgacatcatgcaggtgtccctgtatggctacgtatacacgctctacacacacagcttccagtgctatggccggaatgaggctgagaagaagtttctggcaatgctcctgcagaattctcctaccaaaaaccatctcaccaatccctgttaccctcgggattatagcatcagcttcaccatgggccatgtatttgatagcctgtgcactgtggaccagaggccagaaagttataaccccaatgatgtcatcacttttgaaggaactggggacccatctctgtgtaaggagaaggtggcttccatatttgacttcaaagcttgccatgatcaagaaacctgttcttttgatggggtttatcagccaaagattaaagggccatttgtggcttttgcaggattctactacacagccagtgctttaaatctttcaggtagcttttccctggacaccttcaactccagcacctggaatttctgctcacagaattggagtcagctcccactgctgctccccaaatttgatgaggtatatgcccgctcttactgcttctcagccaactacatctaccacttgtttgtgaacggttacaaattcacagaggagacttggccccaaatacactttgaaaaagaagaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquinol-cytochrome c reductase core protein II
- PRP4 pre-mRNA processing factor 4 homolog (yeast)
- family with sequence similarity 130, member A1
- kelch repeat and BTB (POZ) domain containing 10

Buy ENTPD3-ectonucleoside triphosphate diphosphohydrolase 3 Gene now

Add to cart