ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene View larger

ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017371
Product type: DNA & cDNA
Ncbi symbol: ELK3
Origin species: Human
Product name: ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene
Size: 2ug
Accessions: BC017371
Gene id: 2004
Gene description: ELK3, ETS-domain protein (SRF accessory protein 2)
Synonyms: ELK3, ETS transcription factor; ELK3, ETS-domain protein (SRF accessory protein 2); ERP; NET; SAP-2; SAP2; ETS domain-containing protein Elk-3; ETS-related protein ERP; ETS-related protein NET; SRF accessory protein 2; serum response factor accessory protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagtgcaatcacgctgtggcagttcctgttgcagttgctgctggatcagaaacatgagcatttgatctgctggacctcgaacgatggtgaattcaagctcctcaaagcagaagaagtggccaagctgtggggactccgaaaaaacaaaacaaatatgaactatgataagctgagcagagccctgcgatactattatgacaagaacatcatcaagaaggtgatcgggcagaagtttgtgtacaagtttgtctctttcccggagatcctgaagatggatcctcacgcggtggagatcagccgggagagccttctgctgcaggacagcgactgcaaggcgtctccggagggccgcgaggcccacaaacacggcctggccgccctcagaagcacgagccgcaacgaatacatccactcaggcctgtactcgtccttcaccattaattccctgcagaacccaccagacgccttcaaggccatcaagacggagaagctggaggagccgcccgaagacagcccccccgtggaagaagtcaggactgtgatcaggtttgtgaccaataaaaccgacaagcacgtcaccaggccggtggtgtccctgccttccacgtcagaggctgcggcggcgtccgccttcctggcctcgtccgtctcggccaagatctcctctttaatgttgccaaacgctgccagtatttcatccgcctcacccttctcatctcggtccccgtccctgtcccccaactcacccctcccttctgaacacagaagcctcttcctggaggccgcctgccatgactccgattccctggagcccttgaacctgtcatcgggctccaagaccaagtctccatctcttcccccaaaggccaaaaaacccaaaggcttggaaatctcagcgcccccgctggtgctctccggcaccgacatcggctccatcgccctcaacagcccagccctcccctcgggatccctcaccccagccttcttcaccgcacagacaccaaatggattgcttctgactccgagtccactgctctccagcatacatttctggagcagccttagtccagttgctccgctgagtcctgccaggctgcaagggccaagcacgctgttccagttccccacactgcttaatggccacatgccagtgccaatccccagtctggacagagctgcttctccagtactgctttcttcaaactctcagaaatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ectonucleoside triphosphate diphosphohydrolase 3
- ubiquinol-cytochrome c reductase core protein II
- PRP4 pre-mRNA processing factor 4 homolog (yeast)
- family with sequence similarity 130, member A1

Buy ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene now

Add to cart