Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene
PTXBC036285
New product
Data sheet of PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036285 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRKAR1A |
| Origin species: | Human |
| Product name: | PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene |
| Size: | 2ug |
| Accessions: | BC036285 |
| Gene id: | 5573 |
| Gene description: | protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) |
| Synonyms: | ACRDYS1; ADOHR; CAR; CNC; CNC1; PKR1; PPNAD1; PRKAR1; TSE1; cAMP-dependent protein kinase type I-alpha regulatory subunit; Carney complex type 1; cAMP-dependent protein kinase regulatory subunit RIalpha; cAMP-dependent protein kinase type I-alpha regulatory chain; protein kinase A type 1a regulatory subunit; protein kinase, cAMP-dependent, regulatory subunit type I alpha; protein kinase, cAMP-dependent, regulatory, type I, alpha; tissue-specific extinguisher 1; protein kinase cAMP-dependent type I regulatory subunit alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtctggcagtaccgccgccagtgaggaggcacgcagccttcgagaatgtgagctctacgtccagaagcataacattcaagcgctgctcaaagattctattgtgcagttgtgcactgctcgacctgagagacccatggcattcctcagggaatactttgagaggttggagaaggaggaggcaaaacagattcagaatctgcagaaagcaggcactcgtacagactcaagggaggatgagatttctcctcctccacccaacccagtggttaaaggtaggaggcgacgaggtgctatcagcgctgaggtctacacggaggaagatgcggcatcctatgttagaaaggttataccaaaagattacaagacaatggccgctttagccaaagccattgaaaagaatgtgctgttttcacatcttgatgataatgagagaagtgatatttttgatgccatgttttcggtctcctttatcgcaggagagactgtgattcagcaaggtgatgaaggggataacttctatgtgattgatcaaggagagacggatgtctatgttaacaatgaatgggcaaccagtgttggggaaggagggagctttggagaacttgctttgatttatggaacaccgagagcagccactgtcaaagcaaagacaaatgtgaaattgtggggcatcgaccgagacagctatagaagaatcctcatgggaagcacactgagaaagcggaagatgtatgaggaattccttagtaaagtctctattttagagtctctggacaagtgggaacgtcttacggtagctgatgcattggaaccagtgcagtttgaagatgggcagaagattgtggtgcagggagaaccaggggatgagttcttcattattttagaggggtcagctgctgtgctacaacgtcggtcagaaaatgaagagtttgttgaagtgggaagattggggccttctgattattttggtgaaattgcactactgatgaatcgtcctcgtgctgccacagttgttgctcgtggccccttgaagtgcgttaagctggaccgacctagatttgaacgtgttcttggcccatgctcagacatcctcaaacgaaacatccagcagtacaacagttttgtgtcactgtctgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 - tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide - excision repair cross-complementing rodent repair deficiency, complementation group 6-like - DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) |