PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene View larger

PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036285
Product type: DNA & cDNA
Ncbi symbol: PRKAR1A
Origin species: Human
Product name: PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene
Size: 2ug
Accessions: BC036285
Gene id: 5573
Gene description: protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)
Synonyms: ACRDYS1; ADOHR; CAR; CNC; CNC1; PKR1; PPNAD1; PRKAR1; TSE1; cAMP-dependent protein kinase type I-alpha regulatory subunit; Carney complex type 1; cAMP-dependent protein kinase regulatory subunit RIalpha; cAMP-dependent protein kinase type I-alpha regulatory chain; protein kinase A type 1a regulatory subunit; protein kinase, cAMP-dependent, regulatory subunit type I alpha; protein kinase, cAMP-dependent, regulatory, type I, alpha; tissue-specific extinguisher 1; protein kinase cAMP-dependent type I regulatory subunit alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtctggcagtaccgccgccagtgaggaggcacgcagccttcgagaatgtgagctctacgtccagaagcataacattcaagcgctgctcaaagattctattgtgcagttgtgcactgctcgacctgagagacccatggcattcctcagggaatactttgagaggttggagaaggaggaggcaaaacagattcagaatctgcagaaagcaggcactcgtacagactcaagggaggatgagatttctcctcctccacccaacccagtggttaaaggtaggaggcgacgaggtgctatcagcgctgaggtctacacggaggaagatgcggcatcctatgttagaaaggttataccaaaagattacaagacaatggccgctttagccaaagccattgaaaagaatgtgctgttttcacatcttgatgataatgagagaagtgatatttttgatgccatgttttcggtctcctttatcgcaggagagactgtgattcagcaaggtgatgaaggggataacttctatgtgattgatcaaggagagacggatgtctatgttaacaatgaatgggcaaccagtgttggggaaggagggagctttggagaacttgctttgatttatggaacaccgagagcagccactgtcaaagcaaagacaaatgtgaaattgtggggcatcgaccgagacagctatagaagaatcctcatgggaagcacactgagaaagcggaagatgtatgaggaattccttagtaaagtctctattttagagtctctggacaagtgggaacgtcttacggtagctgatgcattggaaccagtgcagtttgaagatgggcagaagattgtggtgcagggagaaccaggggatgagttcttcattattttagaggggtcagctgctgtgctacaacgtcggtcagaaaatgaagagtttgttgaagtgggaagattggggccttctgattattttggtgaaattgcactactgatgaatcgtcctcgtgctgccacagttgttgctcgtggccccttgaagtgcgttaagctggaccgacctagatttgaacgtgttcttggcccatgctcagacatcctcaaacgaaacatccagcagtacaacagttttgtgtcactgtctgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
- tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
- excision repair cross-complementing rodent repair deficiency, complementation group 6-like
- DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae)

Buy PRKAR1A-protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) Gene now

Add to cart