SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene View larger

SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene

PTXBC001061

New product

Data sheet of SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC001061
Product type: DNA & cDNA
Ncbi symbol: SLC3A2
Origin species: Human
Product name: SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene
Size: 2ug
Accessions: BC001061
Gene id: 6520
Gene description: solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Synonyms: 4F2; 4F2HC; 4T2HC; CD98HC; MDU1; NACAE; 4F2 cell-surface antigen heavy chain; CD98 heavy chain; antigen defined by monoclonal antibody 4F2, heavy chain; antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43; lymphocyte activation antigen 4F2 large subunit; monoclonal antibody 44D7; solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2; solute carrier family 3 (amino acid transporter heavy chain), member 2; solute carrier family 3 member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccaggacaccgaggtggatatgaaggaggtggagctgaatgagttagagcccgagaagcagccgatgaacgcggcgtctggggcggccatgtccctggcgggagccgagaagaatggtctggtgaagatcaaggtggcggaagacgaggcggaggcggcagccgcggctaagttcacgggcctgtccaaggaggagctgctgaaggtggcaggcagccccggctgggtacgcacccgctgggcactgctgctgctcttctggctcggctggctcggcatgcttgctggtgccgtggtcataatcgtgcgagcgccgcgttgtcgcgagctaccggcgcagaagtggtggcacacgggcgccctctaccgcatcggcgaccttcaggccttccagggccacggcgcgggcaacctggcgggtctgaaggggcgtctcgattacctgagctctctgaaggtgaagggccttgtgctgggtccaattcacaagaaccagaaggatgatgtcgctcagactgacttgctgcagatcgaccccaattttggctccaaggaagattttgacagtctcttgcaatcggctaaaaaaaagagcatccgtgtcattctggaccttactcccaactaccggggtgagaactcgtggttctccactcaggttgacactgtggccaccaaggtgaaggatgctctggagttttggctgcaagctggcgtggatgggttccaggttcgggacatagagaatctgaaggatgcatcctcattcttggctgagtggcaaaatatcaccaagggcttcagtgaagacaggctcttgattgcggggactaactcctccgaccttcagcagatcctgagcctactcgaatccaacaaagacttgctgttgactagctcatacctgtctgattctggttctactggggagcatacaaaatccctagtcacacagtatttgaatgccactggcaatcgctggtgcagctggagtttgtctcaggcaaggctcctgacttccttcttgccggctcaacttctccgactctaccagctgatgctcttcaccctgccagggacccctgttttcagctacggggatgagattggcctggatgcagctgcccttcctggacagcctatggaggctccagtcatgctgtgggatgagtccagcttccctgacatcccaggggctgtaagtgccaacatgactgtgaagggccagagtgaagaccctggctccctcctttccttgttccggcggctgagtgaccagcggagtaaggagcgctccctactgcatggggacttccacgcgttctccgctgggcctggactcttctcctatatccgccactgggaccagaatgagcgttttctggtagtgcttaactttggggatgtgggcctctcggctggactgcaggcctccgacctgcctgccagcgccagcctgccagccaaggctgacctcctgctcagcacccagccaggccgtgaggagggctcccctcttgagctggaacgcctgaaactggagcctcacgaagggctgctgctccgcttcccctacgcggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
- excision repair cross-complementing rodent repair deficiency, complementation group 6-like
- DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae)
- solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16

Buy SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene now

Add to cart