Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene
PTXBC001061
New product
Data sheet of SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC001061 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC3A2 |
| Origin species: | Human |
| Product name: | SLC3A2-solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene |
| Size: | 2ug |
| Accessions: | BC001061 |
| Gene id: | 6520 |
| Gene description: | solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 |
| Synonyms: | 4F2; 4F2HC; 4T2HC; CD98HC; MDU1; NACAE; 4F2 cell-surface antigen heavy chain; CD98 heavy chain; antigen defined by monoclonal antibody 4F2, heavy chain; antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43; lymphocyte activation antigen 4F2 large subunit; monoclonal antibody 44D7; solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2; solute carrier family 3 (amino acid transporter heavy chain), member 2; solute carrier family 3 member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccaggacaccgaggtggatatgaaggaggtggagctgaatgagttagagcccgagaagcagccgatgaacgcggcgtctggggcggccatgtccctggcgggagccgagaagaatggtctggtgaagatcaaggtggcggaagacgaggcggaggcggcagccgcggctaagttcacgggcctgtccaaggaggagctgctgaaggtggcaggcagccccggctgggtacgcacccgctgggcactgctgctgctcttctggctcggctggctcggcatgcttgctggtgccgtggtcataatcgtgcgagcgccgcgttgtcgcgagctaccggcgcagaagtggtggcacacgggcgccctctaccgcatcggcgaccttcaggccttccagggccacggcgcgggcaacctggcgggtctgaaggggcgtctcgattacctgagctctctgaaggtgaagggccttgtgctgggtccaattcacaagaaccagaaggatgatgtcgctcagactgacttgctgcagatcgaccccaattttggctccaaggaagattttgacagtctcttgcaatcggctaaaaaaaagagcatccgtgtcattctggaccttactcccaactaccggggtgagaactcgtggttctccactcaggttgacactgtggccaccaaggtgaaggatgctctggagttttggctgcaagctggcgtggatgggttccaggttcgggacatagagaatctgaaggatgcatcctcattcttggctgagtggcaaaatatcaccaagggcttcagtgaagacaggctcttgattgcggggactaactcctccgaccttcagcagatcctgagcctactcgaatccaacaaagacttgctgttgactagctcatacctgtctgattctggttctactggggagcatacaaaatccctagtcacacagtatttgaatgccactggcaatcgctggtgcagctggagtttgtctcaggcaaggctcctgacttccttcttgccggctcaacttctccgactctaccagctgatgctcttcaccctgccagggacccctgttttcagctacggggatgagattggcctggatgcagctgcccttcctggacagcctatggaggctccagtcatgctgtgggatgagtccagcttccctgacatcccaggggctgtaagtgccaacatgactgtgaagggccagagtgaagaccctggctccctcctttccttgttccggcggctgagtgaccagcggagtaaggagcgctccctactgcatggggacttccacgcgttctccgctgggcctggactcttctcctatatccgccactgggaccagaatgagcgttttctggtagtgcttaactttggggatgtgggcctctcggctggactgcaggcctccgacctgcctgccagcgccagcctgccagccaaggctgacctcctgctcagcacccagccaggccgtgaggagggctcccctcttgagctggaacgcctgaaactggagcctcacgaagggctgctgctccgcttcccctacgcggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide - excision repair cross-complementing rodent repair deficiency, complementation group 6-like - DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) - solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 |