Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ERCC6L-excision repair cross-complementing rodent repair deficiency, complementation group 6-like Gene
PTXBC008808
New product
Data sheet of ERCC6L-excision repair cross-complementing rodent repair deficiency, complementation group 6-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ERCC6L-excision repair cross-complementing rodent repair deficiency, complementation group 6-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008808 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ERCC6L |
| Origin species: | Human |
| Product name: | ERCC6L-excision repair cross-complementing rodent repair deficiency, complementation group 6-like Gene |
| Size: | 2ug |
| Accessions: | BC008808 |
| Gene id: | 54821 |
| Gene description: | excision repair cross-complementing rodent repair deficiency, complementation group 6-like |
| Synonyms: | PICH; RAD26L; DNA excision repair protein ERCC-6-like; ATP-dependent helicase ERCC6-like; Plk1-interacting checkpoint helicase; SNF2/RAD54 family protein; excision repair cross-complementation group 6 like; excision repair cross-complementing rodent repair deficiency complementation group 6 - like; excision repair cross-complementing rodent repair deficiency, complementation group 6-like; excision repair protein ERCC6-like; tumor antigen BJ-HCC-15; ERCC excision repair 6 like, spindle assembly checkpoint helicase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaaaaagctttgcaactaaaaatgaagctgtacaaaaagagacattacaagaggggcctaagcaagaggcactgcaagaggatcctctggaaagttttaattatgtacttagcaaatcaaccaaagctgatattgggccaaatttagatcaactaaaggatgatgagattttacgtcattgcaatccttggcccattatttccataacaaatgaaagtcaaaatgcagaatcaaatgtatccattattgaaatagctgatgacctttcagcatcccatagtgcactgcaggatgctcaagcaagtgaggccaagttggaagaggaaccttcagcatcttcaccacagtatgcatgtgatttcaatcttttcttggaagactcagcagacaacagacaaaatttttccagtcagtctttagagcatgttgagaaagaaaatagcttgtgtggctctgcacctaattccagagcagggtttgtgcatagcaaaacatgtctcagttgggagttttctgagaaagacgatgaaccagaagaagtagtagttaaagcaaaaatcagaagtaaagctagaaggattgtttcagatggcgaagatgaagatgattcttttaaagatacctcaagcataaatccattcaacacatctctctttcaattctcatctgtgaaacaatttgatgcttcaactcccaaaaatgacatcagtccaccaggaaggttcttttcatctcaaatacccagtagtgtaaataagtctatgaactctagaagatctctggcttctaggaggtctcttattaatatggttttagaccacgtggaggacatggaggaaagacttgacgacagcagtgaagcaaagggtcctgaagattatccagaagaaggggtggaggaaagcagtggcgaagcctccaagtatacagaagaggatccttccggagaaacactgtcttcagaaaacaagtccagctggttaatgacgtctaagcctagtgctctagctcaagagacctctcttggtgcccctgagcctttgtctggtgaacagttggttggttctccccaggataaggcggcagaggctacaaatgactatgagactcttgtaaagcgtggaaaagaactaaaagagtgtggaaaaatccaggaggccctaaactgcttagttaaagcgcttgacataaaaagtgcagatcctgaagttatgctcttgactttaagtttgtataagcaacttaataacaattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) - solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 - similar to pleckstrin homology domain containing, family M (with RUN domain) member 1; adapter protein 162 - tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide |