No products
Prices are tax excluded
PTXBC032382
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032382 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC440456 |
| Origin species: | Human |
| Product name: | LOC440456-similar to pleckstrin homology domain containing, family M (with RUN domain) member 1, adapter protein 162 Gene |
| Size: | 2ug |
| Accessions: | BC032382 |
| Gene id: | 440456 |
| Gene description: | similar to pleckstrin homology domain containing, family M (with RUN domain) member 1; adapter protein 162 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacctccccgcgaacgggaacgcccgcactagacaaccagccccagaccggcattcccagagccgcaggcgggagggacgcagggactccgggacagcaaatccccgggggagaagggaagggggaaggcgggacaggggaggcccaccctccttgggctccgctagcgaccagccagcgccccttcagacgcagccttcctggctccggaccccggctttctgctccggtcctcgtcccaatgccccccaaggtccccagcagaggcattcaggttcctcctcgccccgcccagacgcagcttctttgggtatgggtgacagcactcctgagcgtcgctgtccctattcgctgccgttgccagctccgattccgcgaaacctctccggcaccacctcggaagccccgcccagggcgatggtccgggcctaacctgccggccccgcccacccggcccttgggctccctgaggcccgcccagcagactcgaggaacgcttgacaaagtggcgaaggagccctacgggagtcccggattggaccctgctccttcggtccctcagcctcggcaagccgcggtctcctggcccttggcctgggtcaccttaggaggcaggaggagatgtggtcagtgtgggagcttggaggggccatgcacttccggagaagaccaccgactcatggctttggtggaggggcgccggcagatttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide - solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 - COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) - ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle |