ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene View larger

ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene


New product

Data sheet of ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016046
Product type: DNA & cDNA
Ncbi symbol: ATP5A1
Origin species: Human
Product name: ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene
Size: 2ug
Accessions: BC016046
Gene id: 498
Gene description: ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Synonyms: ATP5A; ATP5AL2; ATPM; COXPD22; HEL-S-123m; MC5DN4; MOM2; OMR; ORM; hATP1; ATP synthase subunit alpha, mitochondrial; ATP synthase alpha chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle; ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2; ATP sythase (F1-ATPase) alpha subunit; epididymis secretory sperm binding protein Li 123m; mitochondrial ATP synthetase, oligomycin-resistant; ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtccgtgcgcgttgctgcggccgtggtccgcgcccttcctcggcgggccggactggtctccagaaatgctttgggttcatctttcattgctgcaaggaacttccatgcctctaacactcatcttcaaaagactgggactgctgagatgtcctctattcttgaagagcgtattcttggagctgatacctctgttgatcttgaagaaactgggcgtgtcttaagtattggtgatggtattgcccgcgtacatgggctgaggaatgttcaagcagaagaaatggtagagttttcttcaggcttaaagggtatgtccttgaacttggaacctgacaatgttggtgttgtcgtgtttggaaatgataaactaattaaggaaggagatatagtgaagaggacaggagccattgtggacgttccagttggtgaggagctgttgggtcgtgtagttgatgcccttggtaatgctattgatggaaagggtccaattggttccaagacgcgtaggcgagttggtctgaaagcccccggtatcattcctcgaatttcagtgcgggaaccaatgcagactggcattaaggctgtggatagcttggtgccaattggtcgtggtcagcgtgaactgattattggtgaccgacagactgggaaaacctcaattgctattgacacaatcattaaccagaaacgtttcaatgatggatctgatgaaaagaagaagctgtactgtatttatgttgctattggtcaaaagagatccactgttgcccagttggtgaagagacttacagatgcagatgccatgaagtacaccattgtggtgtcggctacggcctcggatgctgccccacttcagtacctggctccttactctggctgttccatgggagagtattttagagacaatggcaaacatgctttgatcatctatgacgacttatccaaacaggctgttgcttaccgtcagatgtctctgttgctccgccgaccccctggtcgtgaggcctatcctggtgatgtgttctacctacactcccggttgctggagagagcagccaaaatgaacgatgcttttggtggtggctccttgactgctttgccagtcatagaaacacaggctggtgatgtgtctgcttacattccaacaaatgtcatttccatcactgacggacagatcttcttggaaacagaattgttctacaaaggtatccgccctgcaattaacgttggtctgtctgtatctcgtgtcggatccgctgcccaaaccagggctatgaagcaggtagcaggtaccatgaagctggaattggctcagtatcgtgaggttgctgcttttgcccagttcggttctgacctcgatgctgccactcaacaacttttgagtcgtggcgtgcgtctaactgagttgctgaagcaaggacagtattctcccatggctattgaagaacaagtggctgttatctatgcgggtgtaaggggatatcttgataaactggagcccagcaagattacaaagtttgagaatgctttcttgtctcatgtcgtcagccagcaccaagccttgttgggcactatcagggctgatggaaagatctcagaacaatcagatgcaaagctgaaagagattgtaacaaatttcttggctggatttgaagcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
- solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
- cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
- potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4

Buy ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene now

Add to cart