Login to display prices
Login to display prices
ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene View larger

ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene

PTXBC016046

New product

Data sheet of ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC016046
Ncbi symbol: ATP5A1
Product name: ATP5A1-ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle Gene
Size: 2ug
Accessions: BC016046
Gene id: 498
Gene description: ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Synonyms: ATP5A; ATP5AL2; ATPM; COXPD22; HEL-S-123m; MC5DN4; MOM2; OMR; ORM; hATP1; ATP synthase subunit alpha, mitochondrial; ATP synthase alpha chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle; ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2; ATP sythase (F1-ATPase) alpha subunit; epididymis secretory sperm binding protein Li 123m; mitochondrial ATP synthetase, oligomycin-resistant; ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtccgtgcgcgttgctgcggccgtggtccgcgcccttcctcggcgggccggactggtctccagaaatgctttgggttcatctttcattgctgcaaggaacttccatgcctctaacactcatcttcaaaagactgggactgctgagatgtcctctattcttgaagagcgtattcttggagctgatacctctgttgatcttgaagaaactgggcgtgtcttaagtattggtgatggtattgcccgcgtacatgggctgaggaatgttcaagcagaagaaatggtagagttttcttcaggcttaaagggtatgtccttgaacttggaacctgacaatgttggtgttgtcgtgtttggaaatgataaactaattaaggaaggagatatagtgaagaggacaggagccattgtggacgttccagttggtgaggagctgttgggtcgtgtagttgatgcccttggtaatgctattgatggaaagggtccaattggttccaagacgcgtaggcgagttggtctgaaagcccccggtatcattcctcgaatttcagtgcgggaaccaatgcagactggcattaaggctgtggatagcttggtgccaattggtcgtggtcagcgtgaactgattattggtgaccgacagactgggaaaacctcaattgctattgacacaatcattaaccagaaacgtttcaatgatggatctgatgaaaagaagaagctgtactgtatttatgttgctattggtcaaaagagatccactgttgcccagttggtgaagagacttacagatgcagatgccatgaagtacaccattgtggtgtcggctacggcctcggatgctgccccacttcagtacctggctccttactctggctgttccatgggagagtattttagagacaatggcaaacatgctttgatcatctatgacgacttatccaaacaggctgttgcttaccgtcagatgtctctgttgctccgccgaccccctggtcgtgaggcctatcctggtgatgtgttctacctacactcccggttgctggagagagcagccaaaatgaacgatgcttttggtggtggctccttgactgctttgccagtcatagaaacacaggctggtgatgtgtctgcttacattccaacaaatgtcatttccatcactgacggacagatcttcttggaaacagaattgttctacaaaggtatccgccctgcaattaacgttggtctgtctgtatctcgtgtcggatccgctgcccaaaccagggctatgaagcaggtagcaggtaccatgaagctggaattggctcagtatcgtgaggttgctgcttttgcccagttcggttctgacctcgatgctgccactcaacaacttttgagtcgtggcgtgcgtctaactgagttgctgaagcaaggacagtattctcccatggctattgaagaacaagtggctgttatctatgcgggtgtaaggggatatcttgataaactggagcccagcaagattacaaagtttgagaatgctttcttgtctcatgtcgtcagccagcaccaagccttgttgggcactatcagggctgatggaaagatctcagaacaatcagatgcaaagctgaaagagattgtaacaaatttcttggctggatttgaagcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: