ALG12-asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) Gene View larger

ALG12-asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALG12-asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ALG12-asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001729
Product type: DNA & cDNA
Ncbi symbol: ALG12
Origin species: Human
Product name: ALG12-asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001729
Gene id: 79087
Gene description: asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
Synonyms: ALG12, alpha-1,6-mannosyltransferase; mannosyltransferase ALG12 homolog; CDG1G; ECM39; PP14673; hALG12; dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase; asparagine-linked glycosylation 12 homolog (S. cerevisiae, alpha-1,6-mannosyltransferase); asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase); asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog; asparagine-linked glycosylation protein 12 homolog; dol-P-Man dependent alpha-1,6-mannosyltransferase; dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase; dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichyl-alpha-1,6-mannosyltransferase; dolichyl-P-mannose:Man-7-GlcNAc-2-PP-dolichyl-alpha-6-mannosyltransferase; membrane protein SB87
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggaaaggggtcatcaggcaggcggcccctgctgctggggctgctggtggccgtagccactgtccacctggtcatctgtccctacaccaaagtggaggagagcttcaacctgcaggccacacatgacctgctctaccactggcaagacctggagcagtacgaccatcttgagttccccggagtcgtccccaggacgttcctcgggccagtggtgatcgcagtgttctccagccccgcggtttacgtgctttcgctgttagaaatgtccaagttttactctcagctaatagttagaggagtgcttggactcggcgtgatttttggactctggacgttacaaaaggaagtgagacggcacttcggggccatggtggccaccatgttctgctgggtgacggccatgcagttccacctgatgttctactgcacgcggacactgcccaatgtgctggccctgcctgtagtcctgctggccctcgcggcctggctgcggcacgagtgggcccgcttcatctggctgtcagccttcgccatcatcgtgttcagggtggagctgtgcctgttcctgggcctcctgctgctgctggccttgggcaaccgaaaggtttctgtagtcagagcccttcgccacgccgtcccggcagggatcctctgtttaggactgacggttgctgtggactcttatttttggcggcagctcacttggccggaaggaaaggtgctttggtacaacactgtcctgaacaaaagctccaactgggggacctccccgctgctgtggtacttctactcagccctgccccgcggcctgggctgcagcctgctcttcatccccctgggcttggtagacagaaggacgcacgcgccgacggtgctggcactgggcttcatggcactctactccctcctgccacacaaggagctacgcttcatcatctatgccttccccatgctcaacatcacggctgccagaggctgctcctacctgctgaataactataaaaagtcttggctgtacaaagcggggtctctgcttgtgatcggacacctcgtggtgaatgccgcctactcagccacggccctgtatgtgtcccatttcaactacccaggtggcgtcgcaatgcagaggctgcaccagctggtgcccccccagacagacgtccttctgcacattgacgtggcagccgcccagacaggtgtgtctcggtttctccaagtcaacagcgcctggaggtacgacaagagggaggatgtgcagccggggacaggcatgctggcatacacacacatcctcatggaggcggcccctgggctcctggccctctacagggacacacaccgggtcctggccagcgtcgtggggaccacaggtgtgagtctgaacctgacccaactgccccccttcaacgtccacctgcagacaaagctggtgcttctggagaggctcccccggccgtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
- cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
- potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5

Buy ALG12-asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) Gene now

Add to cart