Login to display prices
Login to display prices
SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene View larger

SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007355
Product type: DNA & cDNA
Ncbi symbol: SLC25A10
Origin species: Human
Product name: SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene
Size: 2ug
Accessions: BC007355
Gene id: 1468
Gene description: solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
Synonyms: DIC; mitochondrial dicarboxylate carrier; dicarboxylate ion carrier; solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10; solute carrier family 25 member 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagccgaggcgcgcgtgtcgcgctggtacttcggggggctggcctcctgcggggccgcctgctgcacgcacccgctggacctgctcaaggtgcatctgcagacgcagcaggaggtgaagctgcgcatgacgggcatggcgctgcgggtggtgcgtaccgacggcatcctggcactctacagcggcctgagcgcctcgctgtgcagacagatgacctactccctgactcggttcgccatctacgagactgtgcgggaccgtgtggccaagggcagccaggggcctctccccttccacgagaaggtgttgctgggctccgtcagcggtttagctggaggcttcgtggggacgcccgcagacttggtcaacgtcaggatgcagaacgacgtgaagctgccccagggtcagcggcgcaactacgcccatgcgctggatggcctgtaccgcgtagctcgtgaagagggtctcaggagactgttctcgggtgcaaccatggcatccagccgaggggccttagtcactgtgggccagctgtcctgctacgaccaggccaagcagctggtccttagcaccgggtacctctctgacaacatcttcactcactttgtcgccagctttattgcaggtggatgtgccacgttcctgtgccagcccctggatgtgctgaagactcgcctgatgaactccaagggggagtatcagggcgttttccactgcgccgtggagacagcgaagctcgggcctctggccttttacaagggcctcgtcccagctggcatccgcctcatcccccacaccgtgctcacttttgtgtttctggaacagctacgcaaaaactttggcatcaaagtgccatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)
- ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
- asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
- solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10