Login to display prices
Login to display prices
COX10-COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) Gene View larger

COX10-COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) Gene

PTXBC000060

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX10-COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COX10-COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000060
Product type: DNA & cDNA
Ncbi symbol: COX10
Origin species: Human
Product name: COX10-COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) Gene
Size: 2ug
Accessions: BC000060
Gene id: 1352
Gene description: COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)
Synonyms: COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor; COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase; protoheme IX farnesyltransferase, mitochondrial; cytochrome c oxidase assembly homolog 10; cytochrome c oxidase assembly protein; cytochrome c oxidase subunit X; heme A: farnesyltransferase; heme O synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcatctccgcacactctctcctcacgcctcctgacaggttgcgtaggaggctctgtctggtatcttgaaagaagaactatacaggactcccctcacaagttcttacatcttctcaggaatgtcaataagcagtggattacatttcagcactttagcttcctcaaacgcatgtatgtcacacagctgaacagaagccacaaccagcaagtaagacccaagccagaaccagtagcatctcctttccttgaaaaaacatcttcaggtcaagccaaagcagaaatatatgagatgagacctctctcaccgcccagcctatctttgtccagaaagccaaatgaaaaggaattgatagaactagagccagactcagtaattgaagactcaatagatgtagggaaagagacaaaagaggaaaagcggtggaaagagatgaagctgcaagtgtatgatttgccaggaattttggctcaactatccaaaatcaaactcacagctctagttgtaagtaccactgcagctggatttgcattggctccgggcccttttgactggccctgtttcctgcttacttctgttgggacaggccttgcatcctgtgctgccaactccatcaatcagttttttgaggtgccatttgactcaaacatgaataggacaaagaacagaccgctggttcgtggacagatcagcccgttgctagctgtgtcctttgccacttgttgtgctgttccgggagttgccattctgaccttgggggtgaatccactcacaggagccctggggctcttcaacattttcctgtatacctgctgctacacaccactgaaaaggatcagcattgccaacacatgggtcggagctgtggttggggccatcccgcctgtcatgggctggacagcggccacgggcagcctcgatgctggcgcatttctcctgggaggaatcctctactcctggcagtttcctcatttcaacgccctgagctggggcctccgtgaagactactcccggggcggctactgcatgatgtcggtcacccacccgggcctgtgccggcgcgtggcgctgcgccactgcctggccctgctcgtgctgtccgcagcagcccctgtgctggacatcaccacatggaccttccccatcatggcccttcccatcaatgcgtacatctcctacctcggcttccgcttctacgtggacgcagaccgcaggagctcgcggagactgttcttctgcagcctgtggcacctgccgctgctgctgctgctcatgctcacctgcaagcggccgagcggaggcggggacgcagggccccctcccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
- asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
- solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
- cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)