Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene
PTXBC000179
New product
Data sheet of YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000179 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | YWHAE |
| Origin species: | Human |
| Product name: | YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC000179 |
| Gene id: | 7531 |
| Gene description: | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide |
| Synonyms: | 14-3-3E; HEL2; KCIP-1; MDCR; MDS; 14-3-3 protein epsilon; 14-3-3 epsilon; epididymis luminal protein 2; mitochondrial import stimulation factor L subunit; protein kinase C inhibitor protein-1; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide; tyrosine 3/tryptophan 5 -monooxygenase activation protein, epsilon polypeptide; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgatcgagaggatctggtgtaccaggcgaagctggccgagcaggctgagcgatacgacgaaatggtggagtcaatgaagaaagtagcagggatggatgtggagctgacagttgaagaaagaaacctcctatctgttgcatataagaatgtgattggagctagaagagcctcctggagaataatcagcagcattgaacagaaagaagaaaacaagggaggagaagacaagctaaaaatgattcgggaatatcggcaaatggttgagactgagctaaagttaatctgttgtgacattctggatgtactggacaaacacctcattccagcagctaacactggcgagtccaaggttttctattataaaatgaaaggggactaccacaggtatctggcagaatttgccacaggaaacgacaggaaggaggctgcggagaacagcctagtggcttataaagctgctagtgatattgcaatgacagaacttccaccaacgcatcctattcgcttaggtcttgctctcaatttttccgtattctactacgaaattcttaattcccctgaccgtgcctgcaggttggcaaaagcagcttttgatgatgcaattgcagaactggatacgctgagtgaagaaagctataaggactctacacttatcatgcagttgttacgtgataatctgacactatggacttcagacatgcagggtgacggtgaagagcagaataaagaagcgctgcaggacgtggaagacgaaaatcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - excision repair cross-complementing rodent repair deficiency, complementation group 6-like - DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) - solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 - similar to pleckstrin homology domain containing, family M (with RUN domain) member 1; adapter protein 162 |