YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene View larger

YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene

PTXBC000179

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000179
Product type: DNA & cDNA
Ncbi symbol: YWHAE
Origin species: Human
Product name: YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene
Size: 2ug
Accessions: BC000179
Gene id: 7531
Gene description: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Synonyms: 14-3-3E; HEL2; KCIP-1; MDCR; MDS; 14-3-3 protein epsilon; 14-3-3 epsilon; epididymis luminal protein 2; mitochondrial import stimulation factor L subunit; protein kinase C inhibitor protein-1; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide; tyrosine 3/tryptophan 5 -monooxygenase activation protein, epsilon polypeptide; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgatcgagaggatctggtgtaccaggcgaagctggccgagcaggctgagcgatacgacgaaatggtggagtcaatgaagaaagtagcagggatggatgtggagctgacagttgaagaaagaaacctcctatctgttgcatataagaatgtgattggagctagaagagcctcctggagaataatcagcagcattgaacagaaagaagaaaacaagggaggagaagacaagctaaaaatgattcgggaatatcggcaaatggttgagactgagctaaagttaatctgttgtgacattctggatgtactggacaaacacctcattccagcagctaacactggcgagtccaaggttttctattataaaatgaaaggggactaccacaggtatctggcagaatttgccacaggaaacgacaggaaggaggctgcggagaacagcctagtggcttataaagctgctagtgatattgcaatgacagaacttccaccaacgcatcctattcgcttaggtcttgctctcaatttttccgtattctactacgaaattcttaattcccctgaccgtgcctgcaggttggcaaaagcagcttttgatgatgcaattgcagaactggatacgctgagtgaagaaagctataaggactctacacttatcatgcagttgttacgtgataatctgacactatggacttcagacatgcagggtgacggtgaagagcagaataaagaagcgctgcaggacgtggaagacgaaaatcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - excision repair cross-complementing rodent repair deficiency, complementation group 6-like
- DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae)
- solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16
- similar to pleckstrin homology domain containing, family M (with RUN domain) member 1; adapter protein 162

Buy YWHAE-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene now

Add to cart