Login to display prices
Login to display prices
TTC15-tetratricopeptide repeat domain 15 Gene View larger

TTC15-tetratricopeptide repeat domain 15 Gene

PTXBC017475

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTC15-tetratricopeptide repeat domain 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TTC15-tetratricopeptide repeat domain 15 Gene

Proteogenix catalog: PTXBC017475
Ncbi symbol: TTC15
Product name: TTC15-tetratricopeptide repeat domain 15 Gene
Size: 2ug
Accessions: BC017475
Gene id: 51112
Gene description: tetratricopeptide repeat domain 15
Synonyms: TTC15; CGI-87; TTC-15; trafficking protein particle complex subunit 12; TPR repeat protein 15; tetratricopeptide repeat domain 15; tetratricopeptide repeat protein 15; trafficking of membranes and mitosis; trafficking protein particle complex 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttcgctttctgggtgaaaaagctgcagcaaagagacaagtcctaaatgccgactcagtggaacaatcttttgttggattgaaacagctaatcagctgcagaaactggagggcagcagtggacctgtgcggacgtctcctcacagcccacggccagggctacggcaagagcgggctgctcaccagccacacgacagattcactgcagctctggtttgtcaggctggcactactagtgaagttgggccttttccagaatgctgagatggaatttgaacccttcggaaatcttgatcagccagatctttattacgagtactacccgcacgtgtaccctgggcgcaggggctccatggtccccttctcgatgcgcatcttgcacgcggagcttcagcagtacctggggaacccacaggagtcgctggatagactgcacaaggtgaagactgtctgcagcaagatcctggccaatttggagcaaggcttagcagaagacggcggcatgagcagcgtgactcaggagggcagacaagcctctatccggctgtggaggtcacgtctgggccgggtgatgtactccatggcaaactgtctgctcctgatgaaggattatgtgctggccgtggaggcgtatcattcggttatcaagtattacccagagcaagagccccagctgctcagcggcatcggccggatttccctgcagattggagacataaaaacagctgaaaagtattttcaagacgttgagaaagtaacacagaaattagacggactacagggtaaaatcatggttttgatgaacagcgcgttccttcacctcgggcagaataactttgcagaagcccacaggttcttcacagagatcttaaggatggatccaagaaacgcagtggccaacaacaacgctgccgtgtgtctgctctacctgggcaagctcaaggactccctgcggcagctggaggccatggtccagcaggaccccaggcactacctgcacgagagcgtgctcttcaacctgaccaccatgtacgagctggagtcctcacggagcatgcagaagaaacaggccctgctggaggctgtcgccggcaaggagggggacagcttcaacacacagtgcctcaagctggcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: