FLI1-Friend leukemia virus integration 1 Gene View larger

FLI1-Friend leukemia virus integration 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLI1-Friend leukemia virus integration 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FLI1-Friend leukemia virus integration 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001670
Product type: DNA & cDNA
Ncbi symbol: FLI1
Origin species: Human
Product name: FLI1-Friend leukemia virus integration 1 Gene
Size: 2ug
Accessions: BC001670
Gene id: 2313
Gene description: Friend leukemia virus integration 1
Synonyms: EWSR2; SIC-1; Friend leukemia integration 1 transcription factor; Ewing sarcoma breakpoint region 2; Friend leukemia virus integration 1; transcription factor ERGB; Fli-1 proto-oncogene, ETS transcription factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgggactattaaggaggctctgtcggtggtgagcgacgaccagtccctctttgactcagcgtacggagcggcagcccatctccccaaggccgacatgactgcctcggggagtcctgactacgggcagccccacaagatcaaccccctcccaccacagcaggagtggatcaatcagccagtgagggtcaacgtcaagcgggagtatgaccacatgaatggatccagggagtctccggtggactgcagcgttagcaaatgcagcaagctggtgggcggaggcgagtccaaccccatgaactacaacagctatatggacgagaagaatggcccccctcctcccaacatgaccaccaacgagaggagagtcatcgtccccgcagaccccacactgtggacacaggagcatgtgaggcaatggctggagtgggccataaaggagtacagcttgatggagatcgacacatcctttttccagaacatggatggcaaggaactgtgtaaaatgaacaaggaggacttcctccgcgccaccaccctctacaacacggaagtgctgttgtcacacctcagttacctcagggaaagttcactgctggcctataatacaacctcccacaccgaccaatcctcacgattgagtgtcaaagaagacccttcttatgactcagtcagaagaggagcttggggcaataacatgaattctggcctcaacaaaagtcctccccttggaggggcacaaacgatcagtaagaatacagagcaacggccccagccagatccgtatcagatcctgggcccgaccagcagtcgcctagccaaccctggaagcgggcagatccagctgtggcaattcctcctggagctgctctccgacagcgccaacgccagctgtatcacctgggaggggaccaacggggagttcaaaatgacggaccccgatgaggtggccaggcgctggggcgagcggaaaagcaagcccaacatgaattacgacaagctgagccgggccctccgttattactatgataaaaacattatgaccaaagtgcacggcaaaagatatgcttacaaatttgacttccacggcattgcccaggctctgcagccacatccgaccgagtcgtccatgtacaagtacccttctgacatctcctacatgccttcctaccatgcccaccagcagaaggtgaactttgtccctccccatccatcctccatgcctgtcacttcctccagcttctttggagccgcatcacaatactggacctcccccacggggggaatctaccccaaccccaacgtcccccgccatcctaacacccacgtgccttcacacttaggcagctactactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetratricopeptide repeat domain 38
- CaM kinase-like vesicle-associated
- CaM kinase-like vesicle-associated
- leucine rich repeat containing 45

Buy FLI1-Friend leukemia virus integration 1 Gene now

Add to cart