Login to display prices
Login to display prices
TTC38-tetratricopeptide repeat domain 38 Gene View larger

TTC38-tetratricopeptide repeat domain 38 Gene

PTXBC018918

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTC38-tetratricopeptide repeat domain 38 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TTC38-tetratricopeptide repeat domain 38 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018918
Product type: DNA & cDNA
Ncbi symbol: TTC38
Origin species: Human
Product name: TTC38-tetratricopeptide repeat domain 38 Gene
Size: 2ug
Accessions: BC018918
Gene id: 55020
Gene description: tetratricopeptide repeat domain 38
Synonyms: LL22NC03-5H6.5; tetratricopeptide repeat protein 38; TPR repeat protein 38; tetratricopeptide repeat domain 38
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcagcctcgcctctgcgcgactgccaggcctggaaggatgcgaggctcccgctctccaccacaagcaacgaagcctgcaagctgttcgatgccacgctgacccagtatgtaaaatggaccaatgacaagagtctcggtggcatcgagggctgcctgtcaaagctcaaagcagcagatccaacctttgtgatgggccacgccatggctactggccttgtgctgattggcactggaagctccgtgaagctggacaaagagctggacctggctgtgaagacaatggtggagatttcaagaacccagccgctgacaaggcgggagcagctgcacgtgtctgcagtagagacatttgccaatgggaactttccgaaagcctgtgaactatgggaacagattctccaggaccacccgacagacatgttggccctgaaattttcccatgatgcttatttttacctgggctatcaggaacagatgagagattctgttgctcgaatttaccccttctggacacctgacatccccctaagcagctatgtgaaaggcatctactcttttggcttgatggaaaccaacttctacgaccaggcagaaaaactcgccaaagaggctttatctattaacccgacagacgcatggtcggtgcacaccgtcgctcacatccacgagatgaaagcagagatcaaggatgggttggaattcatgcagcactcagagaccctctggaaggactctgatatgttggcttgtcataactattggcactgggctttatatctgattgagaagggcgaatatgaggccgcgctgaccatctacgatacccacatccttcccagcctgcaggccaacgatgcaatgctggacgtggtggacagctgctccatgctctaccgcctgcagatggaaggagtgtctgtgggccagcggtggcaggatgtcctgcctgtggcccggaagcacagccgagaccacatcctgctgttcaatgacgcacacttcctgatggcatccctgggtgcacacgacccccagaccacacaggagctgctgaccaccctgcgggacgccagcgaatccccaggggagaactgccagcacctcctggcccgagacgtggggctgcccctgtgccaggccctggtggaggctgaggacgggaaccctgaccgcgtcctggagctgctcctgcccatccgctaccggatcgtccagctcggtgggagcaatgcccagagagacgtcttcaaccagctgctgattcacgcggccttaaactgcacctccagcgtccataagaacgtagcccggagccttctgatggagcgtgatgccttgaagcccaactcgcccctgaccgagcggctcatccgcaaggcagctaccgtccacctcatgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CaM kinase-like vesicle-associated
- CaM kinase-like vesicle-associated
- leucine rich repeat containing 45
- leucine rich repeat containing 28