TMPRSS4-transmembrane protease, serine 4 Gene View larger

TMPRSS4-transmembrane protease, serine 4 Gene

PTXBC011703

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMPRSS4-transmembrane protease, serine 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMPRSS4-transmembrane protease, serine 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011703
Product type: DNA & cDNA
Ncbi symbol: TMPRSS4
Origin species: Human
Product name: TMPRSS4-transmembrane protease, serine 4 Gene
Size: 2ug
Accessions: BC011703
Gene id: 56649
Gene description: transmembrane protease, serine 4
Synonyms: CAPH2; MT-SP2; TMPRSS3; transmembrane protease serine 4; channel-activating protease 2; membrane-type serine protease 2; transmembrane serine protease 3; type II membrane serine protease; transmembrane protease, serine 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttacaggatcctgacagtgatcaacctctgaacagcctcgatgtcaaacccctgcgcaaaccccgtatccccatggagaccttcagaaaggtggggatccccatcatcatagcactactgagcctggcgagtatcatcattgtggttgtcctcatcaaggtgattctggataaatactacttcctctgcgggcagcctctccacttcatcccgaggaagcagctgtgtgacggagagctggactgtcccttgggggaggacgaggagcactgtgtcaagagcttccccgaagggcctgcagtggcagtccgcctctccaaggaccgatccacactgcaggtgctggactcggccacagggaactggttctctgcctgtttcgacaacttcacagaagctctcgctgagacagcctgtaggcagatgggctacagcagcaaacccactttcagagctgtggagattggcccagaccaggatctggatgttgttgaaatcacagaaaacagccaggagcttcgcatgcggaactcaagtgggccctgtctctcaggctccctggtctccctgcactgtcttgcctgtgggaagagcctgaagaccccccgtgtggtgggtggggaggaggcctctgtggattcttggccttggcaggtcagcatccagtacgacaaacagcacgtctgtggagggagcatcctggacccccactgggtcctcacggcagcccactgcttcaggaaacataccgatgtgttcaactggaaggtgcgggcaggctcagacaaactgggcagcttcccatccctggctgtggccaagatcatcatcattgaattcaaccccatgtaccccaaagacaatgacatcgccctcatgaagctgcagttcccactcactttctcaggcacagtcaggcccatctgtctgcccttctttgatgaggagctcactccagccaccccactctggatcattggatggggctttacgaagcagaatggagggaagatgtctgacatactgctgcaggcgtcagtccaggtcattgacagcacacggtgcaatgcagacgatgcgtaccagggggaagtcaccgagaagatgatgtgtgcaggcatcccggaagggggtgtggacacctgccagggtgacagtggtgggcccctgatgtaccaatctgaccagtggcatgtggtgggcatcgttagctggggctatggctgcgggggcccgagcaccccaggagtatacaccaaggtctcagcctatctcaactggatctacaatgtctggaaggctgagctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Friend leukemia virus integration 1
- tetratricopeptide repeat domain 38
- CaM kinase-like vesicle-associated
- CaM kinase-like vesicle-associated

Buy TMPRSS4-transmembrane protease, serine 4 Gene now

Add to cart