HSD3B1-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 Gene View larger

HSD3B1-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSD3B1-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSD3B1-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031999
Product type: DNA & cDNA
Ncbi symbol: HSD3B1
Origin species: Human
Product name: HSD3B1-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 Gene
Size: 2ug
Accessions: BC031999
Gene id: 3283
Gene description: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Synonyms: 3BETAHSD; HSD3B; HSDB3; HSDB3A; SDR11E1; 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 1; 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type I; 3-beta-HSD I; 3-beta-hydroxy-5-ene steroid dehydrogenase; 3-beta-hydroxy-Delta(5)-steroid dehydrogenase; delta-5-3-ketosteroid isomerase; progesterone reductase; short chain dehydrogenase/reductase family 11E, member 1; steroid Delta-isomerase; trophoblast antigen FDO161G; hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgggctggagctgccttgtgacaggagcaggagggtttctgggacagaggatcatccgcctcttggtgaaggagaaggagctgaaggagatcagggtcttggacaaggccttcggaccagaattgagagaggaattttctaaactccagaacaagaccaagctgacagtgctggaaggagacattctggatgagccattcctgaagagagcctgccaggacgtctcggtcatcatccacaccgcctgtatcattgatgtcttcggtgtcactcacagagagtctatcatgaatgtcaatgtgaaaggtacccagctcctgttagaggcctgtgtccaagctagtgtgccagtcttcatctacaccagtagcatagaggtagccgggcccaactcctacaaggaaatcatccagaatggccatgaagaagagcctctggaaaacacatggcccgctccatacccacacagcaaaaagcttgctgagaaggctgtactggcggctaacgggtggaatctgaaaaacggcggcaccctgtacacttgtgccttacgacccatgtatatctatggggaaggaagccgattcctttctgctagtataaacgaggccctgaacaacaatgggatcctgtcaagtgttggaaagttctccactgttaacccagtctatgttggcaatgtggcctgggcccacattctggccttgagggccctgcaggaccccaagaaggccccaagcatccgaggacagttctactatatctcagatgacacgcctcaccaaagctatgataaccttaattacaccctgagcaaagagttcggcctccgccttgattccagatggagctttcctttatccctgatgtattggattggcttcctgctggaaatagtgagcttcctactcaggccaatttacacctatcgaccgcccttcaaccgccacatagtcacattgtcaaatagcgtattcaccttctcttataagaaggctcagcgagatttggcgtataagccactctacagctgggaggaagccaagcagaaaacggtggagtgggttggttcccttgtggaccggcacaaggagaacctgaagtccaagactcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)
- methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
- pleckstrin homology domain containing, family F (with FYVE domain) member 2
- pleckstrin homology domain containing, family F (with FYVE domain) member 1

Buy HSD3B1-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 Gene now

Add to cart