Login to display prices
Login to display prices
PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene View larger

PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene

PTXBC002744

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene

Proteogenix catalog: PTXBC002744
Ncbi symbol: PLEKHF1
Product name: PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene
Size: 2ug
Accessions: BC002744
Gene id: 79156
Gene description: pleckstrin homology domain containing, family F (with FYVE domain) member 1
Synonyms: APPD; LAPF; PHAFIN1; ZFYVE15; pleckstrin homology domain-containing family F member 1; PH and FYVE domain-containing protein 1; PH domain-containing family F member 1; apoptosis-inducing protein D; lysosome-associated apoptosis-inducing protein containing PH and FYVE domains; phafin 1; pleckstrin homology domain containing, family F (with FYVE domain) member 1; zinc finger FYVE domain-containing protein 15; pleckstrin homology and FYVE domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggaccacttggccaacacggagatcaacagccagcgcatcgcggcagtggagagctgcttcggggcctcggggcagccgctggcgctgccaggccgagtgctgctgggcgagggcgtgctgaccaaagagtgccgcaagaaggccaagccgcgcatcttcttcctctttaacgacatcctggtgtatggcagcatcgtgctcaacaagcgcaagtaccgcagccagcacatcatccccctggaggaggtcacactggagctgttgccggagacgctgcaggccaagaaccgctggatgatcaagacggccaagaagtcctttgtggtgtcggccgcctccgctacggagcgccaggaatggattagccacatcgaggagtgcgtgcggcggcaactgagggccacgggccgcccgcccagcacggagcacgcggcaccctggatccccgacaaggccacggacatctgcatgcgctgcacgcagacgcgcttctctgccctcacgaggcgccaccactgccgcaagtgcggcttcgtggtctgcgctgagtgctcgcgccagcgcttcctgctcccgcgcctgtcccccaagcccgtgcgcgtctgcagcctctgctaccgcgaactggccgcccagcagcggcaggaggaggcggaggagcagggcgcggggtccccagggcagccagcccacctggcccggcccatctgcggagcgtccagtggagatgacgatgactccgacgaggacaaggagggcagcagggacggcgactggcccagcagcgtggagttctacgcctcgggggtggcctggtctgccttccacagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: