PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene View larger

PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002744
Product type: DNA & cDNA
Ncbi symbol: PLEKHF1
Origin species: Human
Product name: PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene
Size: 2ug
Accessions: BC002744
Gene id: 79156
Gene description: pleckstrin homology domain containing, family F (with FYVE domain) member 1
Synonyms: APPD; LAPF; PHAFIN1; ZFYVE15; pleckstrin homology domain-containing family F member 1; PH and FYVE domain-containing protein 1; PH domain-containing family F member 1; apoptosis-inducing protein D; lysosome-associated apoptosis-inducing protein containing PH and FYVE domains; phafin 1; pleckstrin homology domain containing, family F (with FYVE domain) member 1; zinc finger FYVE domain-containing protein 15; pleckstrin homology and FYVE domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggaccacttggccaacacggagatcaacagccagcgcatcgcggcagtggagagctgcttcggggcctcggggcagccgctggcgctgccaggccgagtgctgctgggcgagggcgtgctgaccaaagagtgccgcaagaaggccaagccgcgcatcttcttcctctttaacgacatcctggtgtatggcagcatcgtgctcaacaagcgcaagtaccgcagccagcacatcatccccctggaggaggtcacactggagctgttgccggagacgctgcaggccaagaaccgctggatgatcaagacggccaagaagtcctttgtggtgtcggccgcctccgctacggagcgccaggaatggattagccacatcgaggagtgcgtgcggcggcaactgagggccacgggccgcccgcccagcacggagcacgcggcaccctggatccccgacaaggccacggacatctgcatgcgctgcacgcagacgcgcttctctgccctcacgaggcgccaccactgccgcaagtgcggcttcgtggtctgcgctgagtgctcgcgccagcgcttcctgctcccgcgcctgtcccccaagcccgtgcgcgtctgcagcctctgctaccgcgaactggccgcccagcagcggcaggaggaggcggaggagcagggcgcggggtccccagggcagccagcccacctggcccggcccatctgcggagcgtccagtggagatgacgatgactccgacgaggacaaggagggcagcagggacggcgactggcccagcagcgtggagttctacgcctcgggggtggcctggtctgccttccacagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
- protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
- hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
- hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2

Buy PLEKHF1-pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene now

Add to cart