Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene
PTXBC011549
New product
Data sheet of ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011549 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5S |
| Origin species: | Human |
| Product name: | ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene |
| Size: | 2ug |
| Accessions: | BC011549 |
| Gene id: | 27109 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) |
| Synonyms: | ATPW; HSU79253; ATP synthase subunit s, mitochondrial; ATP synthase coupling factor B, mitochondrial; ATP synthase coupling factor B-like 1; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B); ATP synthase-coupling factor B; mitochondrial ATP synthase regulatory component factor B; ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgctgtgcggtctctgagcagcgactcacctgtgcagatcaaatgatgctgtttggaaaaatttcccagcagttgtgtggcgtaaagaaactcccatggtcatgtgactccagatacttctggggctggttgaatgcagtgtttaataaggtggattatgatcgcatcagggatgttggccctgatagggcggcatccgagtggttgctgcgctgtggggccatggtgcgctaccatggccaggagaggtggcagaaggactacaaccaccttccaacaggccctctggacaaatacaagattcaggcgatcgacgccaccgactcttgtatcatgagcattggatttgatcacatggaaacctcaaatatttgttgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria - pleckstrin homology domain containing, family F (with FYVE domain) member 2 - pleckstrin homology domain containing, family F (with FYVE domain) member 1 - ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 |