Login to display prices
Login to display prices
ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene View larger

ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene

PTXBC011549

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene

Proteogenix catalog: PTXBC011549
Ncbi symbol: ATP5S
Product name: ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene
Size: 2ug
Accessions: BC011549
Gene id: 27109
Gene description: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)
Synonyms: ATPW; HSU79253; ATP synthase subunit s, mitochondrial; ATP synthase coupling factor B, mitochondrial; ATP synthase coupling factor B-like 1; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B); ATP synthase-coupling factor B; mitochondrial ATP synthase regulatory component factor B; ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgctgtgcggtctctgagcagcgactcacctgtgcagatcaaatgatgctgtttggaaaaatttcccagcagttgtgtggcgtaaagaaactcccatggtcatgtgactccagatacttctggggctggttgaatgcagtgtttaataaggtggattatgatcgcatcagggatgttggccctgatagggcggcatccgagtggttgctgcgctgtggggccatggtgcgctaccatggccaggagaggtggcagaaggactacaaccaccttccaacaggccctctggacaaatacaagattcaggcgatcgacgccaccgactcttgtatcatgagcattggatttgatcacatggaaacctcaaatatttgttgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: