ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene View larger

ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011549
Product type: DNA & cDNA
Ncbi symbol: ATP5S
Origin species: Human
Product name: ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene
Size: 2ug
Accessions: BC011549
Gene id: 27109
Gene description: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)
Synonyms: ATPW; HSU79253; ATP synthase subunit s, mitochondrial; ATP synthase coupling factor B, mitochondrial; ATP synthase coupling factor B-like 1; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B); ATP synthase-coupling factor B; mitochondrial ATP synthase regulatory component factor B; ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgctgtgcggtctctgagcagcgactcacctgtgcagatcaaatgatgctgtttggaaaaatttcccagcagttgtgtggcgtaaagaaactcccatggtcatgtgactccagatacttctggggctggttgaatgcagtgtttaataaggtggattatgatcgcatcagggatgttggccctgatagggcggcatccgagtggttgctgcgctgtggggccatggtgcgctaccatggccaggagaggtggcagaaggactacaaccaccttccaacaggccctctggacaaatacaagattcaggcgatcgacgccaccgactcttgtatcatgagcattggatttgatcacatggaaacctcaaatatttgttgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
- pleckstrin homology domain containing, family F (with FYVE domain) member 2
- pleckstrin homology domain containing, family F (with FYVE domain) member 1
- ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1

Buy ATP5S-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B) Gene now

Add to cart