Login to display prices
Login to display prices
PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene View larger

PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene

PTXBC011806

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene

Proteogenix catalog: PTXBC011806
Ncbi symbol: PLEKHF2
Product name: PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene
Size: 2ug
Accessions: BC011806
Gene id: 79666
Gene description: pleckstrin homology domain containing, family F (with FYVE domain) member 2
Synonyms: EAPF; PHAFIN2; ZFYVE18; pleckstrin homology domain-containing family F member 2; PH and FYVE domain-containing protein 2; PH domain-containing family F member 2; endoplasmic reticulum-associated apoptosis-involved protein containing PH and FYVE domains; pleckstrin homology domain containing, family F (with FYVE domain) member 2; zinc finger FYVE domain-containing protein 18; pleckstrin homology and FYVE domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggatcgcttggcaaacagtgaagcaaatactagacgtataagtatagtggaaaactgttttggagcagctggtcaacctttaactatacctggacgagttcttattggagaaggagtattgactaagttgtgcaggaaaaagcccaaagcaaggcagtttttcttgtttaatgatattcttgtatatggcaatattgtcatccagaagaaaaaatataacaaacaacatattattcccctggaaaatgtcactattgattccatcaaagatgagggagacttaaggaatggatggctaatcaagacaccaactaaatcttttgcagtttatgctgccactgctacggagaaatcagaatggatgaatcatataaataaatgtgttactgatttactctccaaaagtgggaagacacccagtaatgaacatgctgctgtctgggttcctgactctgaggcaactgtatgtatgcgttgtcagaaagcaaaattcacacctgttaatcgtcgccaccattgccgcaaatgtggttttgttgtctgtgggccctgctctgaaaagagatttcttcttcccagccagtcctctaagcctgtgcggatttgtgacttctgctatgacctgctttctgctggggacatggccacatgccagcctgctagatcagactcttacagccagtcattgaagtctcctttaaatgatatgtctgatgatgatgacgatgatgatagcagtgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: