CXCR7-chemokine (C-X-C motif) receptor 7 Gene View larger

CXCR7-chemokine (C-X-C motif) receptor 7 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCR7-chemokine (C-X-C motif) receptor 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CXCR7-chemokine (C-X-C motif) receptor 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036661
Product type: DNA & cDNA
Ncbi symbol: CXCR7
Origin species: Human
Product name: CXCR7-chemokine (C-X-C motif) receptor 7 Gene
Size: 2ug
Accessions: BC036661
Gene id: 57007
Gene description: chemokine (C-X-C motif) receptor 7
Synonyms: CXCR7; CMKOR1; CXC-R7; CXCR-7; GPR159; RDC-1; atypical chemokine receptor 3; C-X-C chemokine receptor type 7; G protein-coupled receptor; G-protein coupled receptor 159; G-protein coupled receptor RDC1 homolog; chemokine (C-X-C motif) receptor 7; chemokine orphan receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatctgcatctcttcgactactcagagccagggaacttctcggacatcagctggccatgcaacagcagcgactgcatcgtggtggacacggtgatgtgtcccaacatgcccaacaaaagcgtcctgctctacacgctctccttcatttacattttcatcttcgtcatcggcatgattgccaactccgtggtggtctgggtgaatatccaggccaagaccacaggctatgacacgcactgctacatcttgaacctggccattgccgacctgtgggttgtcctcaccatcccagtctgggtggtcagtctcgtgcagcacaaccagtggcccatgggcgagctcacgtgcaaagtcacacacctcatcttctccatcaacctcttcggcagcattttcttcctcacgtgcatgagcgtggaccgctacctctccatcacctacttcaccaacacccccagcagcaggaagaagatggtacgccgtgtcgtctgcatcctggtgtggctgctggccttctgcgtgtctctgcctgacacctactacctgaagaccgtcacgtctgcgtccaacaatgagacctactgccggtccttctaccccgagcacagcatcaaggagtggctgatcggcatggagctggtctccgttgtcttgggctttgccgttcccttctccattgtcgctgtcttctacttcctgctggccagagccatctcggcgtccagtgaccaggagaagcacagcagccggaagatcatcttctcctacgtggtggtcttccttgtctgctggttgccctaccacgtggcggtgctgctggacatcttctccatcctgcactacatccctttcacctgccggctggagcacgccctcttcacggccctgcatgtcacacagtgcctgtcgctggtgcactgctgcgtcaaccctgtcctctacagcttcatcaatcgcaactacaggtacgagctgatgaaggccttcatcttcaagtactcggccaaaacagggctcaccaagctcatcgatgcctccagagtctcagagacggagtactctgccttggagcagagcaccaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetratricopeptide repeat domain 15
- RasGEF domain family, member 1A
- transmembrane protease, serine 4
- Friend leukemia virus integration 1

Buy CXCR7-chemokine (C-X-C motif) receptor 7 Gene now

Add to cart