NIPA2-non imprinted in Prader-Willi/Angelman syndrome 2 Gene View larger

NIPA2-non imprinted in Prader-Willi/Angelman syndrome 2 Gene

PTXBC011775

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NIPA2-non imprinted in Prader-Willi/Angelman syndrome 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NIPA2-non imprinted in Prader-Willi/Angelman syndrome 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011775
Product type: DNA & cDNA
Ncbi symbol: NIPA2
Origin species: Human
Product name: NIPA2-non imprinted in Prader-Willi/Angelman syndrome 2 Gene
Size: 2ug
Accessions: BC011775
Gene id: 81614
Gene description: non imprinted in Prader-Willi/Angelman syndrome 2
Synonyms: magnesium transporter NIPA2; non-imprinted in Prader-Willi/Angelman syndrome region protein 2; non imprinted in Prader-Willi/Angelman syndrome 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccaggggcgtggaaaatatgacttctatattggtctgggattggctatgagctccagcattttcattggaggaagtttcattttgaaaaaaaagggcctccttcgacttgccaggaaaggctctatgagagcaggtcaaggtggccatgcatatcttaaggaatggttgtggtgggctggactgctgtcaatgggagctggtgaggtggccaacttcgctgcgtatgcgtttgcaccagccactctagtgactccactaggagctctcagcgtgctagtaagtgccattctttcttcatactttctcaatgaaagacttaatcttcatgggaaaattgggtgtttgctaagtattctaggatctacagttatggtcattcatgctccaaaggaagaggagattgagactttaaatgaaatgtctcacaagctaggtgatccaggttttgtggtctttgcaacccttgtggtcattgtggccttgatattaatcttcgtggtgggtcctcgccatggacagacaaacattcttgtgtacataacaatctgctctgtaatcggcgcgttttcagtctcctgtgtgaagggcctgggcattgctatcaaggagctgtttgcagggaagcctgtgctgcggcatcccctggcttggattctgctgctgagcctcatcgtctgtgtgagcacacagattaattacctaaatagggccctggatatattcaacacttccattgtgactccaatatattatgtattctttacaacatcagttttaacttgttcagctattctttttaaggagtggcaagatatgcctgttgacgatgtcattggtactttgagtggcttctttacaatcattgtggggatattcttgttgcatgcctttaaagacgtcggctttagtctagcaagtctgcctgtgtcttttcgaaaagacgagaaagcaatgaatggcaatctctctaatatgtatgaagttcttaataataatgaagaaagcttaacctgtggaatcgaacaacacactggtgaaaatgtctcccgaagaaatggaaatctgacagctttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ELK3, ETS-domain protein (SRF accessory protein 2)
- ectonucleoside triphosphate diphosphohydrolase 3
- ubiquinol-cytochrome c reductase core protein II
- PRP4 pre-mRNA processing factor 4 homolog (yeast)

Buy NIPA2-non imprinted in Prader-Willi/Angelman syndrome 2 Gene now

Add to cart