MRPS22-mitochondrial ribosomal protein S22 Gene View larger

MRPS22-mitochondrial ribosomal protein S22 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS22-mitochondrial ribosomal protein S22 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS22-mitochondrial ribosomal protein S22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009296
Product type: DNA & cDNA
Ncbi symbol: MRPS22
Origin species: Human
Product name: MRPS22-mitochondrial ribosomal protein S22 Gene
Size: 2ug
Accessions: BC009296
Gene id: 56945
Gene description: mitochondrial ribosomal protein S22
Synonyms: C3orf5; COXPD5; GIBT; GK002; MRP-S22; RPMS22; 28S ribosomal protein S22, mitochondrial; S22mt; mitochondrial ribosomal protein S22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccctcggaacaactgtattgctgtggagcctcttgaggagttctccgggcgtggaacgggtctgtttccgggctcgaatccagccctggcacggtggcctgctccaaccgctaccttgctctttcgagatggggctgccacgccgccggttcagctccgaggccgcagaatctggtagcccagagaccaagaagcctacatttatggatgaggaagttcaaagcatactcacgaaaatgacaggcttgaacttgcagaagacttttaagccagctatacaagaactgaagccaccaacctataagctaatgactcaggcacagttggaagaggctacaagacaggcagttgaggcagctaaagtacgattaaaaatgccaccagttctggaagagcgagtaccaataaatgatgtgttagctgaagataagattttggaaggaacagaaacaaccaaatatgtgtttactgatatatcatatagcataccacaccgggagcgttttattgtcgtcagagaaccaagtggcacactacgcaaagcctcttgggaagaacgggaccgaatgatacaagtttatttcccaaaagaaggtcgtaaaattttgacaccaataattttcaaggaagaaaatcttaggactatgtatagccaggacaggcatgttgatgtcctcaatctctgctttgcccagtttgagccagattccacagagtatatcaaggttcatcacaagacctatgaagatatagataaacgtggaaaatatgaccttttacgttcaacaagatactttggtggaatggtgtggtattttgtaaataataaaaagattgatggtttgctgattgaccagattcagagagatttaatcgatgatgcaaccaacttggtccagctgtatcacgtgctccatccagatggccagtcggctcaaggggccaaggatcaggctgctgagggaataaatttaatcaaggtctttgcaaaaacagaagcacagaagggagcctatatagaactaacactgcagacttatcaagaagcactcagtcgccattctgcagcttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 82
- mitogen-activated protein kinase 13
- RNA terminal phosphate cyclase-like 1
- G protein-coupled estrogen receptor 1

Buy MRPS22-mitochondrial ribosomal protein S22 Gene now

Add to cart