Login to display prices
Login to display prices
MRPS22-mitochondrial ribosomal protein S22 Gene View larger

MRPS22-mitochondrial ribosomal protein S22 Gene

PTXBC009296

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS22-mitochondrial ribosomal protein S22 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS22-mitochondrial ribosomal protein S22 Gene

Proteogenix catalog: PTXBC009296
Ncbi symbol: MRPS22
Product name: MRPS22-mitochondrial ribosomal protein S22 Gene
Size: 2ug
Accessions: BC009296
Gene id: 56945
Gene description: mitochondrial ribosomal protein S22
Synonyms: C3orf5; COXPD5; GIBT; GK002; MRP-S22; RPMS22; 28S ribosomal protein S22, mitochondrial; S22mt; mitochondrial ribosomal protein S22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccctcggaacaactgtattgctgtggagcctcttgaggagttctccgggcgtggaacgggtctgtttccgggctcgaatccagccctggcacggtggcctgctccaaccgctaccttgctctttcgagatggggctgccacgccgccggttcagctccgaggccgcagaatctggtagcccagagaccaagaagcctacatttatggatgaggaagttcaaagcatactcacgaaaatgacaggcttgaacttgcagaagacttttaagccagctatacaagaactgaagccaccaacctataagctaatgactcaggcacagttggaagaggctacaagacaggcagttgaggcagctaaagtacgattaaaaatgccaccagttctggaagagcgagtaccaataaatgatgtgttagctgaagataagattttggaaggaacagaaacaaccaaatatgtgtttactgatatatcatatagcataccacaccgggagcgttttattgtcgtcagagaaccaagtggcacactacgcaaagcctcttgggaagaacgggaccgaatgatacaagtttatttcccaaaagaaggtcgtaaaattttgacaccaataattttcaaggaagaaaatcttaggactatgtatagccaggacaggcatgttgatgtcctcaatctctgctttgcccagtttgagccagattccacagagtatatcaaggttcatcacaagacctatgaagatatagataaacgtggaaaatatgaccttttacgttcaacaagatactttggtggaatggtgtggtattttgtaaataataaaaagattgatggtttgctgattgaccagattcagagagatttaatcgatgatgcaaccaacttggtccagctgtatcacgtgctccatccagatggccagtcggctcaaggggccaaggatcaggctgctgagggaataaatttaatcaaggtctttgcaaaaacagaagcacagaagggagcctatatagaactaacactgcagacttatcaagaagcactcagtcgccattctgcagcttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: