PCBP4-poly(rC) binding protein 4 Gene View larger

PCBP4-poly(rC) binding protein 4 Gene

PTXBC017098

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCBP4-poly(rC) binding protein 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCBP4-poly(rC) binding protein 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017098
Product type: DNA & cDNA
Ncbi symbol: PCBP4
Origin species: Human
Product name: PCBP4-poly(rC) binding protein 4 Gene
Size: 2ug
Accessions: BC017098
Gene id: 57060
Gene description: poly(rC) binding protein 4
Synonyms: CBP; LIP4; MCG10; poly(rC)-binding protein 4; LYST-interacting protein; RNA binding protein MCG10; alpha-CP4; poly(rC) binding protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcggctcggacgggggactggaggaggagccagagctcagcatcaccctcacgctgcggatgctgatgcacgggaaggaagtgggcagcatcatcgggaagaagggcgagactgtaaagcgaatccgggagcagagcagtgcccggatcaccatctccgagggctcctgccctgaacgcatcaccaccatcaccgggtctacagcagctgtcttccatgcagtctccatgattgctttcaaactggatgaggacctttgtgctgctcctgcaaatggtggaaatgtctccaggcctccagtgaccctgcgccttgtcatccctgccagtcagtgtggctcactgattgggaaggctggcaccaagatcaaggagatccgagagtccccacccaaaggagccactatcccctaccatccgagcctctccctaggtactgttcttctctctgccaaccagggcttctctgtccagggtcagtatggggctgtgaccccagctgaggtcaccaagctccagcagctctcaagccatgcggtcccctttgccacacccagcgtggtgccaggactggatcccggcacacagaccagctcacaggagttcttggttcccaacgatttgattggctgtgtgatcgggcgccagggcagcaagatcagcgagatccggcagatgtcaggggcacatatcaagatcgggaaccaagcagagggcgctggggagcggcatgtcaccatcactggctctccggtctccatcgccctggcccagtacctcatcactgcctgtctagagacggccaagtctacctctggggggacgcccagctcggcccccgcagacctgcctgcccccttctcgccacccctgacggccctgcccacagctccccctggcctgctgggcacaccctatgccatctccctctccaacttcatcggcctcaagcccatgcccttcttggctttaccacctgcttccccagggccgccgccgggcttggcggcctacactgccaagatggcagcagctaatgggagcaagaaggctgagcggcagaaattctccccctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poly(rC) binding protein 2
- zinc finger protein 385A
- zinc finger protein 385B
- GDP-mannose 4,6-dehydratase

Buy PCBP4-poly(rC) binding protein 4 Gene now

Add to cart