ZNF385A-zinc finger protein 385A Gene View larger

ZNF385A-zinc finger protein 385A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF385A-zinc finger protein 385A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF385A-zinc finger protein 385A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029752
Product type: DNA & cDNA
Ncbi symbol: ZNF385A
Origin species: Human
Product name: ZNF385A-zinc finger protein 385A Gene
Size: 2ug
Accessions: BC029752
Gene id: 25946
Gene description: zinc finger protein 385A
Synonyms: HZF; RZF; ZFP385; ZNF385; zinc finger protein 385A; hematopoietic zinc finger protein; retinal zinc finger protein; zinc finger protein 385
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcccccactggacctcaagcagatcctgcccttcccactcgagccagcccctacccttggcctcttcagcaactacagcaccatggaccctgtgcagaaggctgtgctctcccacacttttgggggacccttgctcaagaccaagcggcccgtcatttcctgtaatatctgtcaaatccgcttcaattctcagagccaggctgaggcgcactacaaaggtaatcgccacgcccgacgagtcaaaggcattgaggctgccaagaccagaggcagggagcctggcgtccgagaacctggagatccagctcccccaggcagcaccccaacaaatggggatggtgtagcaccccgtccagtttccatggagaatggactggggccagccccaggatccccagagaaacagcctggctccccatcccctcccagcattccggagactggtcagggtgtaaccaagggtgaaggggggactccagccccggcttccttgcctgggggtagcaaggaagaggaggagaaagccaagcggctgctctactgtgctctgtgcaaggtggctgtgaactccctgtcccagcttgaggcacataacaaaggtactaagcacaagacaattctggaggcccgaagtgggctcgggcccatcaaagcttaccctcggctggggcctcccaccccgggggaaccagaggctcctgcccaggaccgaactttccactgtgagatctgcaatgtcaaggtcaactcggaggtccaactgaaacagcacatctccagccggcggcaccgagacggcgtggccgggaagcccaacccactactgagccgtcacaagaagtctaggggcgccggggagctggcgggcacgctgactttctccaaggagctgcccaagtccctggcgggcggcctgctccccagccccctggcggtggctgcagtgatggcagcggcagcaggctcgccgctgtccctgcgcccggctccagccgcacctcttctccagggaccgccgatcactcaccctctgcttcacccggcccccggacccatccgaactgcgcacggacccatcctcttctccccgtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 385B
- GDP-mannose 4,6-dehydratase
- kelch domain containing 3
- kelch domain containing 2

Buy ZNF385A-zinc finger protein 385A Gene now

Add to cart