Login to display prices
Login to display prices
GMDS-GDP-mannose 4,6-dehydratase Gene View larger

GMDS-GDP-mannose 4,6-dehydratase Gene

PTXBC000117

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GMDS-GDP-mannose 4,6-dehydratase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GMDS-GDP-mannose 4,6-dehydratase Gene

Proteogenix catalog: PTXBC000117
Ncbi symbol: GMDS
Product name: GMDS-GDP-mannose 4,6-dehydratase Gene
Size: 2ug
Accessions: BC000117
Gene id: 2762
Gene description: GDP-mannose 4,6-dehydratase
Synonyms: GMD; SDR3E1; GDP-mannose 4,6 dehydratase; GDP-D-mannose dehydratase; short chain dehydrogenase/reductase family 3E, member 1; GDP-mannose 4,6-dehydratase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacacgcaccggcacgctgccccagcgcccggggctccggggacggcgagatgggcaagcccaggaacgtggcgctcatcaccggtatcacaggccaggatggttcctacctggctgagttcctgctggagaaaggctatgaggtccatggaattgtacggcggtccagttcatttaatacgggtcgaattgagcatctgtataagaatccccaggctcacattgaaggaaacatgaagttgcactatggcgatctcactgacagtacctgccttgtgaagatcattaatgaagtaaagcccacagagatctacaaccttggagcccagagccacgtcaaaatttcctttgacctcgctgagtacactgcggacgttgacggagttggcactctacgacttctagatgcagttaagacttgtggccttatcaactctgtgaagttctaccaagcctcaacaagtgaactttatgggaaagtgcaggaaataccccagaaggagaccacccctttctatccccggtcaccctatggggcagcaaaactctatgcctattggattgtggtgaacttccgtgaggcgtataatctctttgcagtgaacggcattctcttcaatcatgagagtcccagaagaggagctaatttcgttactcgaaaaattagccggtcagtagctaagatttaccttggacaactggaatgtttcagtttgggaaatctggatgccaaacgagattggggccatgccaaggactatgtggaggctatgtggttgatgttgcagaatgacgagccggaggacttcgttatagctactggggaggtccatagtgtccgggaatttgtcgagaaatcattcttgcacattggaaaaaccattgtgtgggaaggaaagaatgaaaatgaagtgggcagatgtaaagagaccggcaaagttcacgtgactgtggatctcaagtactaccggccaactgaagtggactttctgcagggcgactgcaccaaagcgaaacagaagctgaactggaagccccgggtcgctttcgatgagctggtgagggagatggtgcacgccgacgtggagctcatgaggacaaaccccaatgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: