EDNRA-endothelin receptor type A Gene View larger

EDNRA-endothelin receptor type A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EDNRA-endothelin receptor type A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EDNRA-endothelin receptor type A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022511
Product type: DNA & cDNA
Ncbi symbol: EDNRA
Origin species: Human
Product name: EDNRA-endothelin receptor type A Gene
Size: 2ug
Accessions: BC022511
Gene id: 1909
Gene description: endothelin receptor type A
Synonyms: ET-A; ETA; ETA-R; ETAR; ETRA; MFDA; hET-AR; endothelin-1 receptor; G protein-coupled receptor; endothelin receptor subtype A; endothelin-1-specific receptor; endothelin receptor type A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaccctttgcctcagggcatccttttggctggcactggttggatgtgtaatcagtgataatcctgagagatacagcacaaatctaagcaatcatgtggatgatttcaccacttttcgtggcacagagctcagcttcctggttaccactcatcaacccactaatttggtcctacccagcaatggctcaatgcacaactattgcccacagcagactaaaattacttcagctttcaaatacattaacactgtgatatcttgtactattttcatcgtgggaatggtggggaatgcaactctgctcaggatcatttaccagaacaaatgtatgaggaatggccacaacgcgctgatagccagtcttgcccttggagaccttatctatgtggtcattgatctccctatcaatgtatttaagctgctggctgggcgctggccttttgatcacaatgactttggcgtatttctttgcaagctgttcccctttttgcagaagtcctcggtggggatcaccgtcctcaacctctgcgctcttagtgttgacaggtacagagcagttgcctcctggagtcgtgttcagggaattgggattcctttggtaactgccattgaaattgtctccatctggatcctgtcgtttatcctggccattcctgaagcgattggcttcgtcatggtaccctttgaatataggggtgaacagcataaaacctgtatgctcaatgccacatcaaaattcatggagttctaccaagatgtaaaggactggtggctcttcgggttctatttctgtatgcccttggtgtgcactgcgatcttctacaccctcatgacttgtgagatgttgaacagaaggaatggcagcttgagaattgccctcagtgaacatcttaagcagcgtcgagaagtggcaaaaacagttttctgcttggttgtaatttttgctctttgctggttccctgttcatttaagccgtatattgaagaaaactgtgtataacgagatggacaagaaccgatgtgaattacttagtttcttactgctcatggattacatcggtattaacttggcaaccatgaattcatgtataaaccccatagctctgtattttgtgagcaagaaatttaaaaattgtttccagtcatgcctctgctgctgctgttaccagtccaaaagtctgatgacctcggtccccatgaacggaacaagcatccagtggaaggaccacgatcaaaacaaccacaacacagaccggagcagccataaggacagcatgaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MANSC domain containing 1
- ECSIT homolog (Drosophila)
- cholecystokinin B receptor
- kelch domain containing 4

Buy EDNRA-endothelin receptor type A Gene now

Add to cart