PCBP2-poly(rC) binding protein 2 Gene View larger

PCBP2-poly(rC) binding protein 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCBP2-poly(rC) binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCBP2-poly(rC) binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001155
Product type: DNA & cDNA
Ncbi symbol: PCBP2
Origin species: Human
Product name: PCBP2-poly(rC) binding protein 2 Gene
Size: 2ug
Accessions: BC001155
Gene id: 5094
Gene description: poly(rC) binding protein 2
Synonyms: HNRNPE2; HNRPE2; hnRNP-E2; poly(rC)-binding protein 2; alpha-CP2; heterogeneous nuclear ribonucleoprotein E2; heterogenous nuclear ribonucleoprotein E2; hnRNP E2; poly(rC) binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaattatcactttggctggacccactaatgccatcttcaaagcctttgctatgatcattgacaaactggaagaggacataagcagctctatgaccaatagcacagctgccagtagacccccggtcaccctgaggctggtggtccctgctagtcagtgtggctctctcattggaaaaggtggatgcaagatcaaggaaatacgagagagtacaggggctcaggtccaggtggcaggggatatgctacccaactcaactgagcgggccatcactattgctggcattccacaatccatcattgagtgtgtcaaacagatctgcgtggtcatgttggagtcccccccgaagggcgtgaccatcccgtaccggcccaagccgtccagctctccggtcatctttgcaggtggtcaggacaggtacagcacaggcagcgacagtgcgagctttccccacaccaccccgtccatgtgcctcaaccctgacctggagggaccacctctagaggcctataccattcaaggacagtatgccattccacagccagatttgaccaagctgcaccagttggcaatgcaacagtctcattttcccatgacgcatggcaacaccggattcagtggcattgaatccagctctccagaggtgaaaggctattgggcaggtttggatgcatctgctcagactacttctcatgaactcaccattccaaacgatttgattggctgcataatcgggcgtcaaggcgccaaaatcaatgagatccgtcagatgtctggggcgcagatcaaaattgcgaacccagtggaaggatctactgataggcaggttaccatcactggatctgctgccagcattagcctggctcaatatctaatcaatgtcaggctttcctcggagacgggtggcatggggagcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 385A
- zinc finger protein 385B
- GDP-mannose 4,6-dehydratase
- kelch domain containing 3

Buy PCBP2-poly(rC) binding protein 2 Gene now

Add to cart