C6orf72-chromosome 6 open reading frame 72 Gene View larger

C6orf72-chromosome 6 open reading frame 72 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf72-chromosome 6 open reading frame 72 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf72-chromosome 6 open reading frame 72 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014320
Product type: DNA & cDNA
Ncbi symbol: C6orf72
Origin species: Human
Product name: C6orf72-chromosome 6 open reading frame 72 Gene
Size: 2ug
Accessions: BC014320
Gene id: 116254
Gene description: chromosome 6 open reading frame 72
Synonyms: C6orf72; dJ12G14.2; glycoprotein integral membrane protein 1; glycoprotein integral membrane 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggcgctccaccggggtcgctcgccctccggctcctgctgttcgtggcgctacccgcctccggctggctgacgacgggcgcccccgagccgccgccgctgtccggagccccacaggacggcatcagaattaatgtaactacactgaaagatgatggggacatatctaaacagcaggttgttcttaacataacctatgagagtggacaggtgtatgtaaatgacttacctgtaaatagtggtgtaacccgaataagctgtcagactttgatagtgaagaatgaaaatcttgaaaatttggaggaaaaagaatattttggaattgtcagtgtaaggattttagttcatgagtggcctatgacatctggttccagtttgcaactaattgtcattcaagaagaggtagtagagattgatggaaaacaagttcagcaaaaggatgtcactgaaattgatattttagttaagaaccggggagtactcagacattcaaactataccctccctttggaagaaagcatgctctactctatttctcgagacagtgacattttatttacccttcctaacctctccaaaaaagaaagtgttagttcactgcaaaccactagccagtatcttatcaggaatgtggaaaccactgtagatgaagatgttttacctggcaagttacctgaaactcctctcagagcagagccgccatcttcatataaggtaatgtgtcagtggatggaaaagtttagaaaagatctgtgtaggttctggagcaacgttttcccagtattctttcagtttttgaacatcatggtggttggaattacaggagcagctgtggtaataaccatcttaaaggtgtttttcccagtttctgaatacaaaggaattcttcagttggataaagtggacgtcatacctgtgacagctatcaacttatatccagatggtccagagaaaagagctgaaaaccttgaagataaaacatgtatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein arginine methyltransferase 8
- chromosome 9 open reading frame 68
- mitochondrial ribosomal protein S27
- mitochondrial ribosomal protein L38

Buy C6orf72-chromosome 6 open reading frame 72 Gene now

Add to cart