Login to display prices
Login to display prices
C9orf68-chromosome 9 open reading frame 68 Gene View larger

C9orf68-chromosome 9 open reading frame 68 Gene

PTXBC036349

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf68-chromosome 9 open reading frame 68 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf68-chromosome 9 open reading frame 68 Gene

Proteogenix catalog: PTXBC036349
Ncbi symbol: C9orf68
Product name: C9orf68-chromosome 9 open reading frame 68 Gene
Size: 2ug
Accessions: BC036349
Gene id: 55064
Gene description: chromosome 9 open reading frame 68
Synonyms: C9orf68; bA6J24.2; spermatogenesis associated 6-like protein; spermatogenesis associated 6 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctctggaggtggtggtggagctgcagatccgggcgatttcttgcccaggagtgttcctgcctggcaaacaagatgtgtacctcggggtctacctcatgaatcagtacctggagaccaacagctttccctctgcgttccccattatgattcaggagagcatgagatttgaaaaggtatttgaaagtgcagtagatcctggagctgtagtagaccttttggaaagcttcctagccaggtttgaattaatacagctagttcctccagtgtgggatgagttggcctactacgaagaaaacacacgagattttcttttcccagagcccaagctgacaccttcgcaccctaggaggtgtagggaggtgctcatgaagacggctctgggttttccaggcattgctcccaaaatagagttttctacaaggacagccatcagagaatgtgtgtttctgcatagaaacagatttcttgttgattccaaatcttggctattgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: