C9orf68-chromosome 9 open reading frame 68 Gene View larger

C9orf68-chromosome 9 open reading frame 68 Gene

PTXBC036349

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf68-chromosome 9 open reading frame 68 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf68-chromosome 9 open reading frame 68 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036349
Product type: DNA & cDNA
Ncbi symbol: C9orf68
Origin species: Human
Product name: C9orf68-chromosome 9 open reading frame 68 Gene
Size: 2ug
Accessions: BC036349
Gene id: 55064
Gene description: chromosome 9 open reading frame 68
Synonyms: C9orf68; bA6J24.2; spermatogenesis associated 6-like protein; spermatogenesis associated 6 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctctggaggtggtggtggagctgcagatccgggcgatttcttgcccaggagtgttcctgcctggcaaacaagatgtgtacctcggggtctacctcatgaatcagtacctggagaccaacagctttccctctgcgttccccattatgattcaggagagcatgagatttgaaaaggtatttgaaagtgcagtagatcctggagctgtagtagaccttttggaaagcttcctagccaggtttgaattaatacagctagttcctccagtgtgggatgagttggcctactacgaagaaaacacacgagattttcttttcccagagcccaagctgacaccttcgcaccctaggaggtgtagggaggtgctcatgaagacggctctgggttttccaggcattgctcccaaaatagagttttctacaaggacagccatcagagaatgtgtgtttctgcatagaaacagatttcttgttgattccaaatcttggctattgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S27
- mitochondrial ribosomal protein L38
- chromosome 4 open reading frame 27
- basic leucine zipper and W2 domains 1

Buy C9orf68-chromosome 9 open reading frame 68 Gene now

Add to cart