Login to display prices
Login to display prices
MRPS27-mitochondrial ribosomal protein S27 Gene View larger

MRPS27-mitochondrial ribosomal protein S27 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS27-mitochondrial ribosomal protein S27 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS27-mitochondrial ribosomal protein S27 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030521
Product type: DNA & cDNA
Ncbi symbol: MRPS27
Origin species: Human
Product name: MRPS27-mitochondrial ribosomal protein S27 Gene
Size: 2ug
Accessions: BC030521
Gene id: 23107
Gene description: mitochondrial ribosomal protein S27
Synonyms: MRP-S27; S27mt; 28S ribosomal protein S27, mitochondrial; mitochondrial 28S ribosomal protein S27; mitochondrial ribosomal protein S27
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctctgatatggaaaccaggctaccttgacagagcccttcaagtgatggagaaagtggctgcctccccagaagacataaagctgtgtagagaagcgctcgatgtgctgggtgcagtgctgaaggctctgacttcagctgatggggcttcagaggagcagtcccaaaatgatgaagacaaccaggggtcagaaaaactggtggagcagttagacatcgaggaaacagagcagtccaagcttcctcaatacctggaacgatttaaggccttacattctaagctccaagctctgggcaaaattgagtcagaaggtcttttaagtctgaccacccagcttgtcaaggaaaaactctccacctgtgaagcagaggacatcgccacctatgagcagaatctgcagcagtggcatctagaccttgtacagttgatccagagagaacagcaacagagggagcaagcgaagcaggagtaccaggctcagaaagcagcaaaggcatctgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L38
- chromosome 4 open reading frame 27
- basic leucine zipper and W2 domains 1
- mitochondrial ribosomal protein S22