PRMT8-protein arginine methyltransferase 8 Gene View larger

PRMT8-protein arginine methyltransferase 8 Gene

PTXBC022458

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRMT8-protein arginine methyltransferase 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRMT8-protein arginine methyltransferase 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022458
Product type: DNA & cDNA
Ncbi symbol: PRMT8
Origin species: Human
Product name: PRMT8-protein arginine methyltransferase 8 Gene
Size: 2ug
Accessions: BC022458
Gene id: 56341
Gene description: protein arginine methyltransferase 8
Synonyms: HRMT1L3; HRMT1L4; protein arginine N-methyltransferase 8; HMT1 hnRNP methyltransferase-like 3; arginine methyltransferase 8; heterogeneous nuclear ribonucleoprotein methyltransferase-like protein 4; protein arginine N-methyltransferase 4; protein arginine methyltransferase 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccaagctgctgaacccagaggagatgacctcgagagattattacttcgactcctatgcccactttgggatccacgaggaaatgctgaaggatgaggtgcggactctcacttaccggaactccatgtaccacaacaagcacgtgttcaaggacaaagtggtactggatgtggggagtggtactgggatcctttccatgttcgctgccaaggcaggggccaagaaggtgtttgggatcgaatgctccagtatttctgactactcacagaagatcattaaggccaaccacttggacaacatcatcaccatatttaagggtaaagtggaagaggtggagctgcctgtggagaaggtggacatcatcatcagcgagtggatgggctactgtctgttctatgagtccatgctcaacacggtgatctttgccagggacaagtggctgaaacctggagggcttatgtttccagaccgggcagctttgtacgtggtagcgattgaagacagacagtacaaggacttcaaaatccactggtgggagaatgtctatggctttgacatgacctgcatcagggacgtggccatgaaggagcctctagtggacatcgtggatccaaagcaagtggtgaccaatgcctgtttgataaaggaggtggacatttacacagtgaagacggaagagctatcgttcacatctgcattctgcctgcagatacagcgcaacgactacgtccacgccctggtcacctattttaatattgaatttaccaagtgccacaagaaaatggggttttccacagcccctgatgctccctacacccactggaagcagaccgtcttctacttggaagattacctcactgtccggaggggggaggaaatctacgggaccatatccatgaagccaaatgccaaaaatgtgcgagacctcgatttcacagtagacttggattttaagggacagctgtgtgaaacatctgtatctaatgactacaaaatgcgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 68
- mitochondrial ribosomal protein S27
- mitochondrial ribosomal protein L38
- chromosome 4 open reading frame 27

Buy PRMT8-protein arginine methyltransferase 8 Gene now

Add to cart