RFFL-ring finger and FYVE-like domain containing 1 Gene View larger

RFFL-ring finger and FYVE-like domain containing 1 Gene

PTXBC028424

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RFFL-ring finger and FYVE-like domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RFFL-ring finger and FYVE-like domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028424
Product type: DNA & cDNA
Ncbi symbol: RFFL
Origin species: Human
Product name: RFFL-ring finger and FYVE-like domain containing 1 Gene
Size: 2ug
Accessions: BC028424
Gene id: 117584
Gene description: ring finger and FYVE-like domain containing 1
Synonyms: CARP-2; CARP2; FRING; RIFIFYLIN; RNF189; RNF34L; E3 ubiquitin-protein ligase rififylin; FYVE-RING finger protein SAKURA; RING finger and FYVE-like domain-containing protein 1; RING finger protein 189; caspase 8 and 10 associated RING protein-2; caspase regulator CARP2; caspases-8 and -10-associated RING finger protein 2; ring finger and FYVE-like domain containing 1; ring finger and FYVE like domain containing E3 ubiquitin protein ligase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggcaacctgctgcaactggttctgcctggatggacagcctgaggaggtcccaccaccccagggagccaggatgcaggcctattccaaccctgggtacagctccttcccttccccaacaggcttggaaccaagctgcaagtcctgtggggctcactttgcaaacacggccaggaagcagacctgcttggactgtaagaaaaatttttgcatgacctgttcgagccaagtagggaatgggccccgcctctgccttctctgccaacggtttcgagctacagcctttcagcgagaggagctcatgaagatgaaggtgaaggacttgagggactatctcagcctccatgacatctctaccgaaatgtgccgggagaaaggagagctggtgctcttggtccttggccagcagcctgtaatctcccaggaggacaggactcgtgcctccaccttgtccccagactttcctgagcagcaggccttcctgacccagcctcactccagcatggttccacctacctcacccaacctcccctcttcatctgcacaagccacctctgttcccccagcccaggttcaggagaatcagcagtctattgactcagaggacagctttgtcccaggccgaagggcctctctgtctgacctgactgacctggaggacattgaaggcctgacagtgcggcagctgaaagagatcttggctcgcaactttgtcaactacaagggctgctgtgagaagtgggagctgatggagagagtgacccggctatacaaggatcagaaaggactccagcacctggggggagcagtaccatcaggcttggaggagaacctgtgtaagatctgcatggactcacccattgactgtgttcttctggagtgtggccacatggtaacctgtaccaagtgtggcaagcgcatgaatgaatgtcccatctgccggcagtatgtaatccgagctgtgcatgtcttccggtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - branched chain ketoacid dehydrogenase kinase
- DnaJ (Hsp40) homolog, subfamily B, member 4
- DnaJ (Hsp40) homolog, subfamily B, member 1
- major histocompatibility complex, class I, E

Buy RFFL-ring finger and FYVE-like domain containing 1 Gene now

Add to cart