Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RFFL-ring finger and FYVE-like domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RFFL-ring finger and FYVE-like domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028424 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RFFL |
| Origin species: | Human |
| Product name: | RFFL-ring finger and FYVE-like domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC028424 |
| Gene id: | 117584 |
| Gene description: | ring finger and FYVE-like domain containing 1 |
| Synonyms: | CARP-2; CARP2; FRING; RIFIFYLIN; RNF189; RNF34L; E3 ubiquitin-protein ligase rififylin; FYVE-RING finger protein SAKURA; RING finger and FYVE-like domain-containing protein 1; RING finger protein 189; caspase 8 and 10 associated RING protein-2; caspase regulator CARP2; caspases-8 and -10-associated RING finger protein 2; ring finger and FYVE-like domain containing 1; ring finger and FYVE like domain containing E3 ubiquitin protein ligase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgggcaacctgctgcaactggttctgcctggatggacagcctgaggaggtcccaccaccccagggagccaggatgcaggcctattccaaccctgggtacagctccttcccttccccaacaggcttggaaccaagctgcaagtcctgtggggctcactttgcaaacacggccaggaagcagacctgcttggactgtaagaaaaatttttgcatgacctgttcgagccaagtagggaatgggccccgcctctgccttctctgccaacggtttcgagctacagcctttcagcgagaggagctcatgaagatgaaggtgaaggacttgagggactatctcagcctccatgacatctctaccgaaatgtgccgggagaaaggagagctggtgctcttggtccttggccagcagcctgtaatctcccaggaggacaggactcgtgcctccaccttgtccccagactttcctgagcagcaggccttcctgacccagcctcactccagcatggttccacctacctcacccaacctcccctcttcatctgcacaagccacctctgttcccccagcccaggttcaggagaatcagcagtctattgactcagaggacagctttgtcccaggccgaagggcctctctgtctgacctgactgacctggaggacattgaaggcctgacagtgcggcagctgaaagagatcttggctcgcaactttgtcaactacaagggctgctgtgagaagtgggagctgatggagagagtgacccggctatacaaggatcagaaaggactccagcacctggggggagcagtaccatcaggcttggaggagaacctgtgtaagatctgcatggactcacccattgactgtgttcttctggagtgtggccacatggtaacctgtaccaagtgtggcaagcgcatgaatgaatgtcccatctgccggcagtatgtaatccgagctgtgcatgtcttccggtcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - branched chain ketoacid dehydrogenase kinase - DnaJ (Hsp40) homolog, subfamily B, member 4 - DnaJ (Hsp40) homolog, subfamily B, member 1 - major histocompatibility complex, class I, E |