Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of BCKDK-branched chain ketoacid dehydrogenase kinase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BCKDK-branched chain ketoacid dehydrogenase kinase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009872 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BCKDK |
| Origin species: | Human |
| Product name: | BCKDK-branched chain ketoacid dehydrogenase kinase Gene |
| Size: | 2ug |
| Accessions: | BC009872 |
| Gene id: | 10295 |
| Gene description: | branched chain ketoacid dehydrogenase kinase |
| Synonyms: | BCKDKD; BDK; [3-methyl-2-oxobutanoate dehydrogenase [lipoamide]] kinase, mitochondrial; BCKD-kinase; BCKDHKIN; branched chain alpha-ketoacid dehydrogenase kinase; branched chain ketoacid dehydrogenase kinase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcctggcgtcggtgctgaggagcggtcccgggggcgggcttccgctccggcccctcctgggacccgcactcgcgctccgggcccgctcgacgtcggccaccgacacacaccacgtggagatggctcgggagcgctccaagaccgtcacctccttttacaaccagtcggccatcgacgcggcagcggagaagccctcagtccgcctaacgcccaccatgatgctctacgctggccgctctcaggacggcagccaccttctgaaaagtgctcggtacctgcagcaagaacttccagtgaggattgctcaccgcatcaagggcttccgctgccttcctttcatcattggctgcaaccccaccatactgcacgtgcatgagctatatatccgtgccttccagaagctgacagacttccctccgatcaaggaccaggcggacgaggcccagtactgccagctggtgcgacagctgctggatgaccacaaggatgtggtgaccctcttggcagagggcctacgtgagagccggaagcacatagaggatgaaaagctcgtccgctacttcttggacaagacgctgacttcgaggcttggaatccgcatgttggccacgcatcacctggcgctgcatgaggacaagcctgactttgtcggcatcatctgtactcgtctctcaccaaagaagattattgagaagtgggtggactttgccagacgcctgtgtgagcacaagtatggcaatgcgccccgtgtccgcatcaatggccatgtggctgcccggttccccttcatccctatgccactggactacatcctgccggagctgctcaagaatgccatgaggatctcagaccgtggtggaggaatcgctcacaaagatctggaccgggtcatggactaccacttcactactgctgaggccagcacacaggacccccggatcagccccctctttggccatctggacatgcatagtggcgcccagtcaggacccatgcacgggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 4 - DnaJ (Hsp40) homolog, subfamily B, member 1 - major histocompatibility complex, class I, E - ARP2 actin-related protein 2 homolog (yeast) |