Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002352 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJB1 |
| Origin species: | Human |
| Product name: | DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC002352 |
| Gene id: | 3337 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 1 |
| Synonyms: | HSPF1; Hdj1; RSPH16B; Sis1; dnaJ homolog subfamily B member 1; DnaJ (Hsp40) homolog, subfamily B, member 1; dnaJ protein homolog 1; heat shock 40 kDa protein 1; human DnaJ protein 1; radial spoke 16 homolog B; DnaJ heat shock protein family (Hsp40) member B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtaaagactactaccagacgttgggcctggcccgcggcgcgtcggacgaggagatcaagcgggcctaccgccgccaggcgctgcgctaccacccggacaagaacaaggagcccggcgccgaggagaagttcaaggagatcgctgaggcctacgacgtgctcagcgacccgcgcaagcgcgagatcttcgaccgctacggggaggaaggcctaaaggggagtggccccagtggcggtagcggcggtggtgccaatggtacctctttcagctacacattccatggagaccctcatgccatgtttgctgagttcttcggtggcagaaatccctttgacaccttttttgggcagcggaacggggaggaaggcatggacattgatgacccattctctggcttccctatgggcatgggtggcttcaccaacgtgaactttggccgctcccgctctgcccaagagcccgcccgaaagaagcaagatcccccagtcacccacgaccttcgagtctcccttgaagagatctacagcggctgtaccaagaagatgaaaatctcccacaagcggctaaaccccgacggaaagagcattcgaaacgaagacaaaatattgaccatcgaagtgaagaaggggtggaaagaaggaaccaaaatcactttccccaaggaaggagaccagacctccaacaacattccagctgatatcgtctttgttttaaaggacaagccccacaatatctttaagagagatggctctgatgtcatttatcctgccaggatcagcctccgggaggctctgtgtggctgcacagtgaacgtccccactctggacggcaggacgatacccgtcgtattcaaagatgttatcaggcctggcatgcggcgaaaagttcctggagaaggcctccccctccccaaaacacccgagaaacgtggggacctcattattgagtttgaagtgatcttccccgaaaggattccccagacatcaagaaccgtacttgagcaggttcttccaatatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class I, E - ARP2 actin-related protein 2 homolog (yeast) - DnaJ (Hsp40) homolog, subfamily A, member 4 - von Willebrand factor A domain containing 3B |