Login to display prices
Login to display prices
DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene View larger

DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene

PTXBC002352

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene

Proteogenix catalog: PTXBC002352
Ncbi symbol: DNAJB1
Product name: DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene
Size: 2ug
Accessions: BC002352
Gene id: 3337
Gene description: DnaJ (Hsp40) homolog, subfamily B, member 1
Synonyms: HSPF1; Hdj1; RSPH16B; Sis1; dnaJ homolog subfamily B member 1; DnaJ (Hsp40) homolog, subfamily B, member 1; dnaJ protein homolog 1; heat shock 40 kDa protein 1; human DnaJ protein 1; radial spoke 16 homolog B; DnaJ heat shock protein family (Hsp40) member B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtaaagactactaccagacgttgggcctggcccgcggcgcgtcggacgaggagatcaagcgggcctaccgccgccaggcgctgcgctaccacccggacaagaacaaggagcccggcgccgaggagaagttcaaggagatcgctgaggcctacgacgtgctcagcgacccgcgcaagcgcgagatcttcgaccgctacggggaggaaggcctaaaggggagtggccccagtggcggtagcggcggtggtgccaatggtacctctttcagctacacattccatggagaccctcatgccatgtttgctgagttcttcggtggcagaaatccctttgacaccttttttgggcagcggaacggggaggaaggcatggacattgatgacccattctctggcttccctatgggcatgggtggcttcaccaacgtgaactttggccgctcccgctctgcccaagagcccgcccgaaagaagcaagatcccccagtcacccacgaccttcgagtctcccttgaagagatctacagcggctgtaccaagaagatgaaaatctcccacaagcggctaaaccccgacggaaagagcattcgaaacgaagacaaaatattgaccatcgaagtgaagaaggggtggaaagaaggaaccaaaatcactttccccaaggaaggagaccagacctccaacaacattccagctgatatcgtctttgttttaaaggacaagccccacaatatctttaagagagatggctctgatgtcatttatcctgccaggatcagcctccgggaggctctgtgtggctgcacagtgaacgtccccactctggacggcaggacgatacccgtcgtattcaaagatgttatcaggcctggcatgcggcgaaaagttcctggagaaggcctccccctccccaaaacacccgagaaacgtggggacctcattattgagtttgaagtgatcttccccgaaaggattccccagacatcaagaaccgtacttgagcaggttcttccaatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: