DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene View larger

DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene

PTXBC002352

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002352
Product type: DNA & cDNA
Ncbi symbol: DNAJB1
Origin species: Human
Product name: DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene
Size: 2ug
Accessions: BC002352
Gene id: 3337
Gene description: DnaJ (Hsp40) homolog, subfamily B, member 1
Synonyms: HSPF1; Hdj1; RSPH16B; Sis1; dnaJ homolog subfamily B member 1; DnaJ (Hsp40) homolog, subfamily B, member 1; dnaJ protein homolog 1; heat shock 40 kDa protein 1; human DnaJ protein 1; radial spoke 16 homolog B; DnaJ heat shock protein family (Hsp40) member B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtaaagactactaccagacgttgggcctggcccgcggcgcgtcggacgaggagatcaagcgggcctaccgccgccaggcgctgcgctaccacccggacaagaacaaggagcccggcgccgaggagaagttcaaggagatcgctgaggcctacgacgtgctcagcgacccgcgcaagcgcgagatcttcgaccgctacggggaggaaggcctaaaggggagtggccccagtggcggtagcggcggtggtgccaatggtacctctttcagctacacattccatggagaccctcatgccatgtttgctgagttcttcggtggcagaaatccctttgacaccttttttgggcagcggaacggggaggaaggcatggacattgatgacccattctctggcttccctatgggcatgggtggcttcaccaacgtgaactttggccgctcccgctctgcccaagagcccgcccgaaagaagcaagatcccccagtcacccacgaccttcgagtctcccttgaagagatctacagcggctgtaccaagaagatgaaaatctcccacaagcggctaaaccccgacggaaagagcattcgaaacgaagacaaaatattgaccatcgaagtgaagaaggggtggaaagaaggaaccaaaatcactttccccaaggaaggagaccagacctccaacaacattccagctgatatcgtctttgttttaaaggacaagccccacaatatctttaagagagatggctctgatgtcatttatcctgccaggatcagcctccgggaggctctgtgtggctgcacagtgaacgtccccactctggacggcaggacgatacccgtcgtattcaaagatgttatcaggcctggcatgcggcgaaaagttcctggagaaggcctccccctccccaaaacacccgagaaacgtggggacctcattattgagtttgaagtgatcttccccgaaaggattccccagacatcaagaaccgtacttgagcaggttcttccaatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class I, E
- ARP2 actin-related protein 2 homolog (yeast)
- DnaJ (Hsp40) homolog, subfamily A, member 4
- von Willebrand factor A domain containing 3B

Buy DNAJB1-DnaJ (Hsp40) homolog, subfamily B, member 1 Gene now

Add to cart