VWA3B-von Willebrand factor A domain containing 3B Gene View larger

VWA3B-von Willebrand factor A domain containing 3B Gene

PTXBC022028

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VWA3B-von Willebrand factor A domain containing 3B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VWA3B-von Willebrand factor A domain containing 3B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022028
Product type: DNA & cDNA
Ncbi symbol: VWA3B
Origin species: Human
Product name: VWA3B-von Willebrand factor A domain containing 3B Gene
Size: 2ug
Accessions: BC022028
Gene id: 200403
Gene description: von Willebrand factor A domain containing 3B
Synonyms: SCAR22; von Willebrand factor A domain-containing protein 3B; VWA domain-containing protein 3B; von Willebrand factor A domain containing 3B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacgaaaggcatgaggttgaaatccacaaaagaggtgttccctctggcacatgtgtgcaacgacacaaataagatgacattaattaacccccaaggagccaaactcaatatctacaagcgaaaagtggaacaggcaattcaatcctatgaaaagcgcttgaataaaattgtttggcgagcattatctcaagaggaaaaagaaaagttagatgcaaacaaaccaatacagtacttggaaaacaaaacagttttaaaccaggctttagaacggttgaattggcccatttcactgaaagagctgtcgatgctggaaagtgaaatcctagctgggaaaatgtacatccagcaggccatggaactccaggaggctgccaagaagaattatgcaaacaaggccccgggagagcaacagaaattgcaaggaaatccaacaaagaaaaccaaatcaaaaagaccagatcccctcaaaggacagaaggttattgcaagatgcgatgaaaatggcttttattttccaggggttgtgaagaagtgtgtgagccgcacccaagcactggtgggcttcagttacggagacaccaaggtcgtgtccacctccttcatcacgcctgtggggggcgccatgccctgcccgctgctccaggttggagattatgtgtttgccaaaattgtgatacccaaaggatttgacttctatgtccctgccattgtcatagcacttcccaataagcatgtggccacagaaaaattctacacagttttgaagtgtaacaaccggagagaattttgccctcggagtgcacttattaagatcagccaaaacaagtatgcgctctcttgctctcatataaagtcacccccaattcctgagggtccagaagtagaggatgtggaggcgaggaactctgctttcctcttctggccactgaaagaagcggacacgcaggattccagagagccaagacgagagaagcccaggaggaaaaagaggcccgccaagcagccactccagcaggcggcgccctcggactcggacggctcctcccacggcatcagctcccatgggtcctgccaggggacacaccccgagcccaagacagcccacctccacttccccgcggccgggcgtctaggactcagcagccacgccatcattgccacacctccacctcgagcagccctgccctgtactctccaagccacccacagcagcaaagggctgaggagcgtccctgagacactttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and MYND domain containing 1
- v-akt murine thymoma viral oncogene homolog 1
- aldehyde dehydrogenase 3 family, member A2
- aldehyde dehydrogenase 1 family, member B1

Buy VWA3B-von Willebrand factor A domain containing 3B Gene now

Add to cart