AKT1-v-akt murine thymoma viral oncogene homolog 1 Gene View larger

AKT1-v-akt murine thymoma viral oncogene homolog 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AKT1-v-akt murine thymoma viral oncogene homolog 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AKT1-v-akt murine thymoma viral oncogene homolog 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000479
Product type: DNA & cDNA
Ncbi symbol: AKT1
Origin species: Human
Product name: AKT1-v-akt murine thymoma viral oncogene homolog 1 Gene
Size: 2ug
Accessions: BC000479
Gene id: 207
Gene description: v-akt murine thymoma viral oncogene homolog 1
Synonyms: CWS6; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA; RAC-alpha serine/threonine-protein kinase; AKT1m; PKB alpha; RAC-PK-alpha; protein kinase B alpha; proto-oncogene c-Akt; rac protein kinase alpha; serine-threonine protein kinase; v-akt murine thymoma viral oncogene homolog 1; v-akt murine thymoma viral oncogene-like protein 1; AKT serine/threonine kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgacgtggctattgtgaaggagggttggctgcacaaacgaggggagtacatcaagacctggcggccacgctacttcctcctcaagaatgatggcaccttcattggctacaaggagcggccgcaggatgtggaccaacgtgaggctcccctcaacaacttctctgtggcgcagtgccagctgatgaagacggagcggccccggcccaacaccttcatcatccgctgcctgcagtggaccactgtcatcgaacgcaccttccatgtggagactcctgaggagcgggaggagtggacaaccgccatccagactgtggctgacggcctcaagaagcaggaggaggaggagatggacttccggtcgggctcacccagtgacaactcaggggctgaagagatggaggtgtccctggccaagcccaagcaccgcgtgaccatgaacgagtttgagtacctgaagctgctgggcaagggcactttcggcaaggtgatcctggtgaaggagaaggccacaggccgctactacgccatgaagatcctcaagaaggaagtcatcgtggccaaggacgaggtggcccacacactcaccgagaaccgcgtcctgcagaactccaggcaccccttcctcacagccctgaagtactctttccagacccacgaccgcctctgctttgtcatggagtacgccaacgggggcgagctgttcttccacctgtcccgggagcgtgtgttctccgaggaccgggcccgcttctatggcgctgagattgtgtcagccctggactacctgcactcggagaagaacgtggtgtaccgggacctcaagctggagaacctcatgctggacaaggacgggcacattaagatcacagacttcgggctgtgcaaggaggggatcaaggacggtgccaccatgaagaccttttgcggcacacctgagtacctggcccccgaggtgctggaggacaatgactacggccgtgcagtggactggtgggggctgggcgtggtcatgtacgagatgatgtgcggtcgcctgcccttctacaaccaggaccatgagaagctttttgagctcatcctcatggaggagatccgcttcccgcgcacgcttggtcccgaggccaagtccttgctttcagggctgctcaagaaggaccccaagcagaggcttggcgggggctccgaggacgccaaggagatcatgcagcatcgcttctttgccggtatcgtgtggcagcacgtgtacgagaagaagctcagcccacccttcaagccccaggtcacgtcggagactgacaccaggtattttgatgaggagttcacggcccagatgatcaccatcacaccacctgaccaagatgacagcatggagtgtgtggacagcgagcgcaggccccacttcccccagttctcctactcggccagcggcacggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aldehyde dehydrogenase 3 family, member A2
- aldehyde dehydrogenase 1 family, member B1
- chaperonin containing TCP1, subunit 3 (gamma)
- aldehyde dehydrogenase 4 family, member A1

Buy AKT1-v-akt murine thymoma viral oncogene homolog 1 Gene now

Add to cart