ALDH4A1-aldehyde dehydrogenase 4 family, member A1 Gene View larger

ALDH4A1-aldehyde dehydrogenase 4 family, member A1 Gene

PTXBC007581

New product

Data sheet of ALDH4A1-aldehyde dehydrogenase 4 family, member A1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALDH4A1-aldehyde dehydrogenase 4 family, member A1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC007581
Product type: DNA & cDNA
Ncbi symbol: ALDH4A1
Origin species: Human
Product name: ALDH4A1-aldehyde dehydrogenase 4 family, member A1 Gene
Size: 2ug
Accessions: BC007581
Gene id: 8659
Gene description: aldehyde dehydrogenase 4 family, member A1
Synonyms: ALDH4; P5CD; P5CDh; delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial; L-glutamate gamma-semialdehyde dehydrogenase; P5C dehydrogenase; aldehyde dehydrogenase family 4 member A1; mitochondrial delta-1-pyrroline 5-carboxylate dehydrogenase; aldehyde dehydrogenase 4 family member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgccggcgcccgcgctccgccgcgccctgctgtcccgcccctggaccggggccggcctgcggtggaagcacacctcctccctgaaggtggccaacgagcccgtcttagccttcacgcagggcagccctgagcgagatgccctgcaaaaggccttgaaggacctgaagggccggatggaagccatcccatgcgtggtgggggatgaggaggtgtggacgtcggacgtgcagtaccaagtgtcgccttttaaccatggacataaggtggccaagttctgttatgcagacaagagcctgctcaacaaagccattgaggctgccctggctgcccggaaagagtgggacctgaagcctattgcagaccgggcccagatcttcctgaaggcggcagacatgctgagtgggccgcgcagggctgagatcctcgccaagaccatggtgggacagggtaagaccgtgatccaagcggagattgacgctgcagcggaactcatcgacttcttccggttcaatgccaagtatgcggtggagctggaggggcagcagcccatcagcgtgcccccgagcaccaacagcacggtgtaccggggtctggagggcttcgtggcggccatctcgccctttaacttcactgcaatcggcggcaacctggcgggggcaccggccctgatgggcaacgtggtcctatggaagcccagtgacactgccatgctggccagctatgctgtctaccgcatccttcgggaggctggcctgccccccaacatcatccagtttgtgccagctgatgggcccctatttggggacactgtcaccagctcagagcacctctgtggcatcaacttcacaggcagtgtgcccaccttcaaacacctgtggaagcaggtggcccagaacctggaccggttccacaccttcccacgcctggctggagagtgcggcggaaagaacttccacttcgtgcaccgctcggccgacgtggagagcgtggtgagcgggaccctccgctcagccttcgagtacggtggccagaagtgttccgcctgctcgcgtctctacgtgccgcactcgctgtggccgcagatcaaagggcggctgctggaggagcacagtcggatcaaagtgggcgaccctgcagaggattttgggaccttcttctctgcagtgattgatgccaagtcctttgcccgtatcaagaagtggctggagcacgcacgctcctcacccagcctcaccatcctggccgggggcaagtgtgatgactccgtgggctactttgtggagccctgcatcgtggagagcaaggaccctcaggagcccatcatgaaggaggagatcttcgggcctgtactgtctgtgtacgtctacccggatgacaagtacaaggagacgctgcagctgattgacagcaccaccagctatggcctcacgggggcagtgttctcccaggataaggacgtcgtgcaggaggccacaaaggtgctgaggaatgctgccggcaacttctacatcaacgacaagtccactggctcgatagtgggccagcagccctttgggggggcccgagcctctggaaccaatgacaagccagggggcccacactacatcctgcgctggacgtcgccgcaggtcatcaaggagacacataagcccctgggggactggagctacgcgtacatgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FERM, RhoGEF and pleckstrin domain protein 2
- La ribonucleoprotein domain family, member 1
- DnaJ (Hsp40) homolog, subfamily C, member 4
- neurogranin (protein kinase C substrate, RC3)

Buy ALDH4A1-aldehyde dehydrogenase 4 family, member A1 Gene now

Add to cart