CCT3-chaperonin containing TCP1, subunit 3 (gamma) Gene View larger

CCT3-chaperonin containing TCP1, subunit 3 (gamma) Gene


New product

Data sheet of CCT3-chaperonin containing TCP1, subunit 3 (gamma) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCT3-chaperonin containing TCP1, subunit 3 (gamma) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008019
Product type: DNA & cDNA
Ncbi symbol: CCT3
Origin species: Human
Product name: CCT3-chaperonin containing TCP1, subunit 3 (gamma) Gene
Size: 2ug
Accessions: BC008019
Gene id: 7203
Gene description: chaperonin containing TCP1, subunit 3 (gamma)
Synonyms: CCT-gamma; CCTG; PIG48; TCP-1-gamma; TRIC5; T-complex protein 1 subunit gamma; T-complex protein 1, gamma subunit; TCP1 (t-complex-1) ring complex, polypeptide 5; chaperonin containing TCP1, subunit 3 (gamma); hTRiC5; chaperonin containing TCP1 subunit 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccatcgtccagtgctcgtgctcagccagaacacaaagcgtgaatccggaagaaaagttcaatctggaaacatcaatgctgccaagactattgcagatatcatccgaacatgtttgggacccaagtccatgatgaagatgcttttggacccaatgggaggcattgtgatgaccaatgatggcaatgccattcttcgagagattcaagtccagcatccagcggccaagtccatgatcgaaattagccggacccaggatgaagaggttggagatgggaccacatcagtaattattcttgcaggggaaatgctgtctgtagctgagcacttcctggagcagcagatgcacccaacagtggtgatcagtgcttaccgcaaggcattggatgatatgatcagcaccctaaagaaaataagtatcccagtcgacatcagtgacagtgatatgatgctgaacatcatcaacagctctattactaccaaagccatcagtcggtggtcatctttggcttgcaacattgccctggatgctgtcaagatggtacagtttgaggagaatggtcggaaagagattgacataaaaaaatatgcaagagtggaaaagatacctggaggcatcattgaagactcctgtgtcttgcgtggagtcatgattaacaaggatgtgacccatccacgtatgcggcgctatatcaagaaccctcgcattgtgctgctggattcttctctggaatacaagaaaggagaaagccagactgacattgagattacacgagaggaggacttcacccgaattctccagatggaggaagagtacatccagcagctctgtgaggacattatccaactgaagcccgatgtggtcatcactgaaaagggcatctcagatttagctcagcactaccttatgcgggccaatatcacagccatccgcagagtccggaagacagacaataatcgcattgctagagcctgtggggcccggatagtcagccgaccagaggaactgagagaagatgatgttggaacaggagcaggcctgttggaaatcaagaaaattggagatgaatactttactttcatcactgactgcaaagaccccaaggcctgcaccattctcctccggggggctagcaaagagattctctcggaagtagaacgcaacctccaggatgccatgcaagtgtgtcgcaatgttctcctggaccctcagctggtgccagggggtggggcctccgagatggctgtggcccatgccttgacagaaaaatccaaggccatgactggtgtggaacaatggccatacagggctgttgcccaggccctagaggtcattcctcgtaccctgatccagaactgtggggccagcaccatccgtctacttacctcccttcgggccaagcacacccaggagaactgtgagacctggggtgtaaatggtgagacgggtactttggtggacatgaaggaactgggcatatgggagccattggctgtgaagctgcagacttataagacagcagtggagacggcagttctgctactgcgaattgatgacatcgtttcaggccacaaaaagaaaggcgatgaccagagccggcaaggcggggctcctgatgctggccaggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aldehyde dehydrogenase 4 family, member A1
- FERM, RhoGEF and pleckstrin domain protein 2
- La ribonucleoprotein domain family, member 1
- DnaJ (Hsp40) homolog, subfamily C, member 4