HLA-E-major histocompatibility complex, class I, E Gene View larger

HLA-E-major histocompatibility complex, class I, E Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-E-major histocompatibility complex, class I, E Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-E-major histocompatibility complex, class I, E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002578
Product type: DNA & cDNA
Ncbi symbol: HLA-E
Origin species: Human
Product name: HLA-E-major histocompatibility complex, class I, E Gene
Size: 2ug
Accessions: BC002578
Gene id: 3133
Gene description: major histocompatibility complex, class I, E
Synonyms: HLA-6.2; QA1; HLA class I histocompatibility antigen, alpha chain E; MHC class I antigen E; major histocompatibility complex, class I, E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtagatggaaccctccttttactcctctcggaggccctggcccttacccagacctgggcgggctcccactccttgaagtatttccacacttccgtgtcccggcccggccgcggggagccccgcttcatctctgtgggctacgtggacgacacccagttcgtgcgcttcgacaacgacgccgcgagtccgaggatggtgccgcgggcgccgtggatggagcaggaggggtcagagtattgggaccgggagacacggagcgccagggacaccgcacagattttccgagtgaacctgcggacgctgcgcggctactacaatcagagcgaggccgggtctcacaccctgcagtggatgcatggctgcgagctggggcccgacaggcgcttcctccgcgggtatgaacagttcgcctacgacggcaaggattatctcaccctgaatgaggacctgcgctcctggaccgcggtggacacggcggctcagatctccgagcaaaagtcaaatgatgcctctgaggcggagcaccagagagcctacctggaagacacatgcgtggagtggctccacaaatacctggagaaggggaaggagacgctgcttcacctggagcccccaaagacacacgtgactcaccaccccatctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcaggatggggagggccatacccaggacacggagctcgtggagaccaggcctgcaggggatggaaccttccagaagtgggcagctgtggtggtgccttctggagaggagcagagatacacgtgccatgtgcagcatgaggggctacccgagcccgtcaccctgagatggaagccggcttcccagcccaccatccccatcgtgggcatcattgctggcctggttctccttggatctgtggtctctggagctgtggttgctgctgtgatatggaggaagaagagctcaggtggaaaaggagggagctactctaaggctgagtggagcgacagtgcccaggggtctgagtctcacagcttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ARP2 actin-related protein 2 homolog (yeast)
- DnaJ (Hsp40) homolog, subfamily A, member 4
- von Willebrand factor A domain containing 3B
- ankyrin repeat and MYND domain containing 1

Buy HLA-E-major histocompatibility complex, class I, E Gene now

Add to cart