Login to display prices
Login to display prices
FLJ10357-hypothetical protein FLJ10357 Gene View larger

FLJ10357-hypothetical protein FLJ10357 Gene

PTXBC009992

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLJ10357-hypothetical protein FLJ10357 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ10357-hypothetical protein FLJ10357 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009992
Product type: DNA & cDNA
Ncbi symbol: FLJ10357
Origin species: Human
Product name: FLJ10357-hypothetical protein FLJ10357 Gene
Size: 2ug
Accessions: BC009992
Gene id: 55701
Gene description: hypothetical protein FLJ10357
Synonyms: SOLO; rho guanine nucleotide exchange factor 40; Rho guanine nucleotide exchange factor (GEF) 40; protein SOLO
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggctggcccttacctgccccgagccctgcagcagcctctggaacagctgactcggtatgggcggctcctggaggagctcctgagggaagctgggcctgagctcagttctgagtgccgggcccttggggctgctgtacagctgctccgggaacaagaggcccgtggcagagacctgctggccgtggaggcggtgcgtggctgtgagatagatctgaaggagcagggacagctcttgcatcgagaccccttcactgtcatctgtggccgaaagaagtgccttcgccatgtctttctcttcgagcatctcctcctgttcagcaagctcaagggccctgaaggggggtcagagatgtttgtttacaagcaggcctttaagactgctgatatggggctgacagaaaacatcggggacagcggactctgctttgagttgtggtttcggcggcggcgtgcacgagaggcatacactctgcaggcaacctcaccagagatcaaactcaagtggacaagttctattgcccagctgctgtggagacaggcagcccacaacaaggagctccgagtgcagcagatggtgtccatgggcattgggaataaacccttcctggacatcaaagcccttggggagcggacgctgagtgccctgctcactggaagagccgcccgcacccgggcctccgtggccgtgtcatcctttgagcatgccggcccctcccttcccggcctttcgccgggagcctgctccctgcctgcccgcgtcgaggaggaggcctgggatctggacgtcaagcaaatttccctggccccagaaacacttgactcttctggagatgtgtccccaggaccaagaaacagccccagcctgcaacccccccaccctgggagcagcactcccaccctggccagtcgagggatcttagggctatcccgacagagtcatgctcgagccctgagtgaccccaccacgcctctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calcium binding protein 39-like
- ADAM metallopeptidase domain 22
- platelet derived growth factor D
- ELMO/CED-12 domain containing 3