Cart 32 Product Products 3 666,70 € (empty)
-
1 x OGG1-8-oxo...121,50 € -
1 x NFIA-nucle...121,50 € -
-
1 x C1orf217-c...113,40 € -
1 x PIGK-phosp...121,50 € -
1 x C17orf75-c...121,50 € -
1 x LOC389458-...113,40 € -
1 x SUCNR1-suc...121,50 € -
1 x AQP10-aqua...121,50 € -
1 x CABC1-chap...121,50 € -
1 x DPH5-DPH5...113,40 € -
1 x CENPM-cent...113,40 € -
-
-
1 x STAG3L4-st...113,40 € -
1 x NEIL2-nei...121,50 € -
1 x TMEM168-tr...121,50 € -
-
1 x CCM2-cereb...113,40 € -
1 x CRNN-cornu...121,50 € -
-
-
-
1 x NAT1-N-ace...121,50 € -
1 x DDX39-DEAD...121,50 € -
1 x CCNE2-cycl...121,50 € -
-
1 x GNAO1-guan...121,50 € -
1 x ADORA2A-ad...121,50 € -
1 x C1QBP-comp...121,50 € -
1 x AQP12B-aqu...121,50 € -
No products
To be determined Shipping
3 666,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 666,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 666,70 €
Data sheet of FLJ10357-hypothetical protein FLJ10357 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ10357-hypothetical protein FLJ10357 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009992 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ10357 |
| Origin species: | Human |
| Product name: | FLJ10357-hypothetical protein FLJ10357 Gene |
| Size: | 2ug |
| Accessions: | BC009992 |
| Gene id: | 55701 |
| Gene description: | hypothetical protein FLJ10357 |
| Synonyms: | SOLO; rho guanine nucleotide exchange factor 40; Rho guanine nucleotide exchange factor (GEF) 40; protein SOLO |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggctggcccttacctgccccgagccctgcagcagcctctggaacagctgactcggtatgggcggctcctggaggagctcctgagggaagctgggcctgagctcagttctgagtgccgggcccttggggctgctgtacagctgctccgggaacaagaggcccgtggcagagacctgctggccgtggaggcggtgcgtggctgtgagatagatctgaaggagcagggacagctcttgcatcgagaccccttcactgtcatctgtggccgaaagaagtgccttcgccatgtctttctcttcgagcatctcctcctgttcagcaagctcaagggccctgaaggggggtcagagatgtttgtttacaagcaggcctttaagactgctgatatggggctgacagaaaacatcggggacagcggactctgctttgagttgtggtttcggcggcggcgtgcacgagaggcatacactctgcaggcaacctcaccagagatcaaactcaagtggacaagttctattgcccagctgctgtggagacaggcagcccacaacaaggagctccgagtgcagcagatggtgtccatgggcattgggaataaacccttcctggacatcaaagcccttggggagcggacgctgagtgccctgctcactggaagagccgcccgcacccgggcctccgtggccgtgtcatcctttgagcatgccggcccctcccttcccggcctttcgccgggagcctgctccctgcctgcccgcgtcgaggaggaggcctgggatctggacgtcaagcaaatttccctggccccagaaacacttgactcttctggagatgtgtccccaggaccaagaaacagccccagcctgcaacccccccaccctgggagcagcactcccaccctggccagtcgagggatcttagggctatcccgacagagtcatgctcgagccctgagtgaccccaccacgcctctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium binding protein 39-like - ADAM metallopeptidase domain 22 - platelet derived growth factor D - ELMO/CED-12 domain containing 3 |