ELMOD3-ELMO/CED-12 domain containing 3 Gene View larger

ELMOD3-ELMO/CED-12 domain containing 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELMOD3-ELMO/CED-12 domain containing 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ELMOD3-ELMO/CED-12 domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010991
Product type: DNA & cDNA
Ncbi symbol: ELMOD3
Origin species: Human
Product name: ELMOD3-ELMO/CED-12 domain containing 3 Gene
Size: 2ug
Accessions: BC010991
Gene id: 84173
Gene description: ELMO/CED-12 domain containing 3
Synonyms: DFNB88; LST3; RBED1; RBM29; ELMO domain-containing protein 3; ELMO/CED-12 domain containing 3; RNA binding motif and ELMO/CED-12 domain 1; RNA-binding motif and ELMO domain-containing protein 1; RNA-binding motif protein 29; deafness, autosomal recessive 88; liver-specific organic anion transporter 3TM12; organic anion transporter LST-3b; ELMO domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgaaaaatcttgctctttccatagtaaagaagaattaagagatggacagggtgaaagattgtctgctggatattctccatcatatgacaaggacaagagtgttctggctttcagaggaatccctatctcagagttgaagaaccatggcattctccaggctctgaccacagaagcttatgaatgggagccacgtgttgtgagtacagaggtggtcagagcccaagaagaatgggaagctgtggacaccatccagccagagacagggagccaagctagctcagagcagcctgggcagctaatctccttcagtgaggccctgcagcacttccagactgtggacctttcccccttcaagaaaagaatccagccaactattcgaaggactgggctcgccgccctccgacactacctcttcgggcctccaaagctccaccagcgccttcgggaagaaagggacttggtcctgaccattgctcagtgtggcctggatagccaagacccagtgcatggccgagtcctccagaccatctataagaagctgaccggctccaagtttgactgtgcccttcatggaaaccactgggaggacctgggctttcagggagcgaatccagccacagacctgagaggcgcaggcttccttgccctcctgcatctgctctacctggtgatggactcaaagaccttgccgatggcgcaggagattttccgcctgtctcgtcaccacatccagcaattccctttctgtttgatgtccgtgaacatcacccacattgccatccaggccttgagagaggagtgtctctccagagagtgtaatcggcagcagaaggtcatccccgtggtgaacagcttctatgccgccacattcctccatctcgcacatgtctggaggacacagcggaagaccatctcagactcgggctttgtcctcaaagagttggaagtattggccaagaagagcccactgcggctgctcaagaccctggagctgtacttggccagggtgtcaaagggacaggcctccttgttgggagcacagaagtgctatgggccagaagcccctcccttcaaggatctcaccttcacaggtgagagtgacctgcagtctcactcatccgaaggcgtatggctgatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DENN/MADD domain containing 1B
- SERPINE1 mRNA binding protein 1
- zinc finger, ZZ-type containing 3
- retinoblastoma binding protein 4

Buy ELMOD3-ELMO/CED-12 domain containing 3 Gene now

Add to cart