RBBP4-retinoblastoma binding protein 4 Gene View larger

RBBP4-retinoblastoma binding protein 4 Gene

PTXBC003092

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBBP4-retinoblastoma binding protein 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBBP4-retinoblastoma binding protein 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003092
Product type: DNA & cDNA
Ncbi symbol: RBBP4
Origin species: Human
Product name: RBBP4-retinoblastoma binding protein 4 Gene
Size: 2ug
Accessions: BC003092
Gene id: 5928
Gene description: retinoblastoma binding protein 4
Synonyms: histone-binding protein RBBP4; NURF55; lin-53; CAF-1 subunit C; CAF-I 48 kDa subunit; CAF-I p48; MSI1 protein homolog; RBBP-4; chromatin assembly factor 1 subunit C; chromatin assembly factor I p48 subunit; chromatin assembly factor/CAF-1 p48 subunit; nucleosome-remodeling factor subunit RBAP48; retinoblastoma-binding protein 4; retinoblastoma-binding protein p48; RB binding protein 4, chromatin remodeling factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgacaaggaagcagccttcgacgacgcagtggaagaacgagtgatcaacgaggaatacaaaatatggaaaaagaacaccccttttctttatgatttggtgatgacccatgctctggagtggcccagcctaactgcccagtggcttccagatgtaaccagaccagaagggaaagatttcagcattcatcgacttgtcctggggacacacacatcggatgaacaaaaccatcttgttatagccagtgtgcagctccctaatgatgatgctcagtttgatgcgtcacactacgacagtgagaaaggagaatttggaggttttggttcagttagtggaaaaattgaaatagaaatcaagatcaaccatgaaggagaagtaaacagggcccgttatatgccccagaacccttgtatcatcgcaacaaagactccttccagtgatgttcttgtctttgactatacaaaacatccttctaaaccagatccttctggagagtgcaacccagacttgcgtctccgtggacatcagaaggaaggctatgggctttcttggaacccaaatctcagtgggcacttacttagtgcttcagatgaccataccatctgcctgtgggacatcagtgccgttccaaaggagggaaaagtggtagatgcgaagaccatctttacagggcatacggcagtagtagaagatgtttcctggcatctactccatgagtctctgtttgggtcagttgctgatgatcagaaacttatgatttgggatactcgttcaaacaatacttccaaacccagccactcagttgatgctcacactgctgaagtgaactgcctttctttcaatccttatagtgagttcattcttgccacaggatcagctgacaagactgttgccttgtgggatctgagaaatctgaaacttaagttgcattcctttgagtcacataaggatgaaatattccaggttcagtggtcacctcacaatgagactattttagcttccagtggtactgatcgcagactgaatgtctgggatttaagtaaaattggagaggaacaatccccagaagatgcagaagacgggccaccagagttgttgtttattcatggtggtcatactgccaagatatctgatttctcctggaatcccaatgaaccttgggtgatttgttctgtatcagaagacaatatcatgcaagtgtggcaaatggcagagaacatttataatgatgaagaccctgaaggaagcgtggatccagaaggacaagggtcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein BC002926
- folliculin interacting protein 1
- dachshund homolog 1 (Drosophila)
- heat shock transcription factor 1

Buy RBBP4-retinoblastoma binding protein 4 Gene now

Add to cart