ADAM22-ADAM metallopeptidase domain 22 Gene View larger

ADAM22-ADAM metallopeptidase domain 22 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADAM22-ADAM metallopeptidase domain 22 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ADAM22-ADAM metallopeptidase domain 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036029
Product type: DNA & cDNA
Ncbi symbol: ADAM22
Origin species: Human
Product name: ADAM22-ADAM metallopeptidase domain 22 Gene
Size: 2ug
Accessions: BC036029
Gene id: 53616
Gene description: ADAM metallopeptidase domain 22
Synonyms: metalloproteinase-disintegrin ADAM22-3; ADAM 22; MDC2; disintegrin and metalloproteinase domain-containing protein 22; a disintegrin and metalloproteinase domain 22; metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2; ADAM metallopeptidase domain 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggcggcagtggctgtgtccgtgcccttcttgctgctctgtgtcctggggacctgccctccggcgcgctgcggccaggcaggagacgcctcattgatggagctagagaagaggaaggaaaaccgcttcgtggagcgccagagcatcgtgccactgcgcctcatctaccgctcgggcggcgaagacgaaagtcggcacgacgcgctcgacacgcgggtgcggggcgacgtcggtggcccgcagttgactcatgttgaccaagcaagcttccaggttgatgcctttggaacgtcattcattctcgatgtcgtgctaaatcatgatttgctgtcctctgaatacatagagagacacattgaacatggaggcaagactgtggaagttaaaggaggagagcactgttactaccagggccatatccgaggaaaccctgactcatttgttgcattgtcaacatgccacggacttcatgggatgttctatgacgggaaccacacatatctcattgagccagaagaaaatgacactactcaagaggatttccattttcattcagtttacaaatccagactgtttgaattttccttggatgatcttccatctgaatttcagcaagtaaacattactccatcaaaatttattttgaagccaagaccaaaaaggagtaaacggcagcttcgtcgatatcctcgtaatgtagaagaagaaaccaaatacattgaactgatgattgtgaatgatcaccttatgtttaaaaaacatcggctttccgttgtacataccaatacctatgcgaaatctgtggtgaacatggcagatttaatatataaagaccaacttaagaccaggatagtattggttgctatggaaacctgggcgactgacaacaagtttgccatatctgaaaatccattgatcaccctacgtgagtttatgaaatacaggagggattttatcaaagagaaaagtgatgcagttcaccttttttcgtacgtaacttctgtaatgatgtattactttttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - platelet derived growth factor D
- ELMO/CED-12 domain containing 3
- DENN/MADD domain containing 1B
- SERPINE1 mRNA binding protein 1

Buy ADAM22-ADAM metallopeptidase domain 22 Gene now

Add to cart