PDGFD-platelet derived growth factor D Gene View larger

PDGFD-platelet derived growth factor D Gene

PTXBC030645

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDGFD-platelet derived growth factor D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDGFD-platelet derived growth factor D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030645
Product type: DNA & cDNA
Ncbi symbol: PDGFD
Origin species: Human
Product name: PDGFD-platelet derived growth factor D Gene
Size: 2ug
Accessions: BC030645
Gene id: 80310
Gene description: platelet derived growth factor D
Synonyms: IEGF; MSTP036; SCDGF-B; SCDGFB; platelet-derived growth factor D; PDGF-D; iris-expressed growth factor; spinal cord-derived growth factor B; platelet derived growth factor D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaccggctcatctttgtctacactctaatctgcgcaaacttttgcagctgtcgggacacttctgcaaccccgcagagcgcatccatcaaagctttgcgcaacgccaacctcaggcgagatgacttgtaccgaagagatgagaccatccaggtgaaaggaaacggctacgtgcagagtcctagattcccgaacagctaccccaggaacctgctcctgacatggcggcttcactctcaggagaatacacggatacagctagtgtttgacaatcagtttggattagaggaagcagaaaatgatatctgtaggtatgattttgtggaagttgaagatatatccgaaaccagtaccattattagaggacgatggtgtggacacaaggaagttcctccaaggataaaatcaagaacgaaccaaattaaaatcacattcaagtccgatgactactttgtggctaaacctggattcaagatttattattctttgctggaagatttccaacccgcagcagcttcagagaccaactgggaatctgtcacaagctctatttcaggggtatcctataactctccatcagtaacggatcccactctgattgcggatgctctggacaaaaaaattgcagaatttgatacagtggaagatctgctcaagtacttcaatccagagtcatggcaagaagatcttgagaatatgtatctggacacccctcggtatcgaggcaggtcataccatgaccggaagtcaaaagttgacctggataggctcaatgatgatgccaagcgttacagttgcactcccaggaattactcggtcaatataagagaagagctgaagttggccaatgtggtcttctttccacgttgcctcctcgtgcagcgctgtggaggaaattgtggctgtggaactgtcaactggaggtcctgcacatgcaattcagggaaaaccgtgaaaaagtatcatgaggtattacagtttgagcctggccacatcaagaggaggggtagagctaagaccatggctctagttgacatccagttggatcaccatgaacgatgtgattgtatctgcagctcaagaccacctcgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ELMO/CED-12 domain containing 3
- DENN/MADD domain containing 1B
- SERPINE1 mRNA binding protein 1
- zinc finger, ZZ-type containing 3

Buy PDGFD-platelet derived growth factor D Gene now

Add to cart