C1GALT1C1-C1GALT1-specific chaperone 1 Gene View larger

C1GALT1C1-C1GALT1-specific chaperone 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1GALT1C1-C1GALT1-specific chaperone 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1GALT1C1-C1GALT1-specific chaperone 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011930
Product type: DNA & cDNA
Ncbi symbol: C1GALT1C1
Origin species: Human
Product name: C1GALT1C1-C1GALT1-specific chaperone 1 Gene
Size: 2ug
Accessions: BC011930
Gene id: 29071
Gene description: C1GALT1-specific chaperone 1
Synonyms: C1GALT2; C38H2-L1; COSMC; HSPC067; MST143; TNPS; C1GALT1-specific chaperone 1; C38H2-like protein 1; beta 1,3-galactosyltransferase 2; core 1 beta1,3-galactosyltransferase 2; core 1 beta3-Gal-T2; core 1 beta3-galactosyltransferase-specific molecular chaperone; C1GALT1 specific chaperone 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctttctgaaagcagctcctttttgaagggtgtgatgcttggaagcattttctgtgctttgatcactatgctaggacacattaggattggtcatggaaatagaatgcaccaccatgagcatcatcacctacaagctcctaacaaagaagatatcttgaaaatttcagaggatgagcgcatggagctcagtaagagctttcgagtatactgtattatccttgtaaaacccaaagatgtgagtctttgggctgcagtaaaggagacttggaccaaacactgtgacaaagcagagttcttcagttctgaaaatgttaaagtgtttgagtcaattaatatggacacaaatgacatgtggttaatgatgagaaaagcttacaaatacgcctttgataagtatagagaccaatacaactggttcttccttgcacgccccactacgtttgctatcattgaaaacctaaagtattttttgttaaaaaaggatccatcacagcctttctatctaggccacactataaaatctggagaccttgaatatgtgggtatggaaggaggaattgtcttaagtgtagaatcaatgaaaagacttaacagccttctcaatatcccagaaaagtgtcctgaacagggagggatgatttggaagatatctgaagataaacagctagcagtttgcctgaaatatgctggagtatttgcagaaaatgcagaagatgctgatggaaaagatgtatttaataccaaatctgttgggctttctattaaagaggcaatgacttatcaccccaaccaggtagtagaaggctgttgttcagatatggctgttacttttaatggactgactccaaatcagatgcatgtgatgatgtatggggtataccgccttagggcatttgggcatattttcaatgatgcattggttttcttacctccaaatggttctgacaatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein FLJ10357
- calcium binding protein 39-like
- ADAM metallopeptidase domain 22
- platelet derived growth factor D

Buy C1GALT1C1-C1GALT1-specific chaperone 1 Gene now

Add to cart