C3orf31-chromosome 3 open reading frame 31 Gene View larger

C3orf31-chromosome 3 open reading frame 31 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf31-chromosome 3 open reading frame 31 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf31-chromosome 3 open reading frame 31 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015088
Product type: DNA & cDNA
Ncbi symbol: C3orf31
Origin species: Human
Product name: C3orf31-chromosome 3 open reading frame 31 Gene
Size: 2ug
Accessions: BC015088
Gene id: 132001
Gene description: chromosome 3 open reading frame 31
Synonyms: C3orf31; RAM41; TAM41; phosphatidate cytidylyltransferase, mitochondrial; CDP-DAG synthase; CDP-diacylglycerol synthase; MMP37-like protein, mitochondrial; TAM41, mitochondrial translocator assembly and maintenance protein, homolog; mitochondrial translocator assembly and maintenance protein 41 homolog; TAM41 mitochondrial translocator assembly and maintenance homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgcagacgctgcagagctcgtgggtgaccttccgcaagatcctgtctcacttccccgaggagctgagtctggctttcgtctacggctccggggtgtaccgccaggcagggccgagttcagaccagaagaatgctatgctggactttgtgttcacagtagatgaccctgtcgcatggcattcaaagaacctgaagaaaaattggagtcactactctttcctaaaagttttagggcccaagattatcacgtccatccagaataactatggcgctggagtttactacaattcattgatcatgtgtaatggtaggcttatcaaatatggagttattagcactaacgttctgattgaagatctcctcaactggaataacttatacattgctggacgactccaaaaaccggtgaaaattatctcagtgaacgaggatgtcactcttagatcagccctcgatagaaatctgaagagtgctgtgaccgctgctttcctcatgctccccgaaagcttttctgaagaagacctcttcatagagattgccggtctctcctattcaggtgactttcggatggtggttggagaagataaaacaaaagtgttgaatattgtgaagcccaatatagcccactttcgagagctctatggcagcatactacaggaaaatcctcaagtggtgtataaaagccagcaaggctggctggagatagataaaagcccagaaggacagttcactcagctgatgacattgcccaaaaccttacagcaacagataaatcatattatggaccctcctggaaaaaacagagatgtggaagaaactttattccaagtggctcatgatcccgactgtggagatgtggtgcgactaggcctgaagaagtcagtgatttatagttcactaaaactgcacaaaatgtggaaagggtggctgaggaaaacatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 13 open reading frame 3
- chromosome 6 open reading frame 72
- protein arginine methyltransferase 8
- chromosome 9 open reading frame 68

Buy C3orf31-chromosome 3 open reading frame 31 Gene now

Add to cart