BCCIP-BRCA2 and CDKN1A interacting protein Gene View larger

BCCIP-BRCA2 and CDKN1A interacting protein Gene

PTXBC009771

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCCIP-BRCA2 and CDKN1A interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BCCIP-BRCA2 and CDKN1A interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009771
Product type: DNA & cDNA
Ncbi symbol: BCCIP
Origin species: Human
Product name: BCCIP-BRCA2 and CDKN1A interacting protein Gene
Size: 2ug
Accessions: BC009771
Gene id: 56647
Gene description: BRCA2 and CDKN1A interacting protein
Synonyms: TOK-1; TOK1; BRCA2 and CDKN1A-interacting protein; BCCIPalpha; BCCIPbeta; BRCA2 and Cip1/p21 interacting protein; TOK-1alpha; TOK-1beta; cdk inhibitor p21 binding protein; p21- and CDK-associated protein 1; protein TOK-1; BRCA2 and CDKN1A interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccaggtctaagcggcgtgccgtggaaagtggggttccgcagccgccggatcccccagtccagcgcgacgaggaagaggaaaaagaagtcgaaaatgaggatgaagacgatgatgacagtgacaaggaaaaggatgaagaggacgaggtcattgacgaggaagtgaatattgaatttgaagcttattccctatcagataatgattatgacggaattaagaaattactgcagcagctttttctaaaggctcctgtgaacactgcagaactaacagatctcttaattcaacagaaccatattgggagtgtgattaagcaaacggatgtttcagaagacagcaatgatgatatggatgaagatgaggtttttggtttcataagccttttaaatttaactgaaagaaagggtacccagtgtgttgaacaaattcaagagttggttctacgcttctgtgagaagaactgtgaaaagagcatggttgaacagctggacaagtttttaaatgacaccaccaagcctgtgggccttctcctaagtgaaagattcattaatgtccctccacagatcgctctgcccatgtaccagcagcttcagaaagaactggcgggggcacacagaaccaataagccatgtgggaagtgctacttttaccttctgattagtaagacatttgtggaagcagaaaaaaacaattccaaaaagaaacctagcaacaaaaagaaagctgcgttaatgtttgcaaatgcagaggaagaatttttctatgagaaggcaattctcaagttcaactactcagtgcaggaggagagcgacacttgtctgggaggcaaatggtcttttgatgacgtaccaatgacgcccttgcgaactgtgatgttaattccaggcgacaagatgaacgaaatcatggataaactgaaagaatatctatctgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 3 open reading frame 31
- chromosome 13 open reading frame 3
- chromosome 6 open reading frame 72
- protein arginine methyltransferase 8

Buy BCCIP-BRCA2 and CDKN1A interacting protein Gene now

Add to cart