CISD2-CDGSH iron sulfur domain 2 Gene View larger

CISD2-CDGSH iron sulfur domain 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CISD2-CDGSH iron sulfur domain 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CISD2-CDGSH iron sulfur domain 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032300
Product type: DNA & cDNA
Ncbi symbol: CISD2
Origin species: Human
Product name: CISD2-CDGSH iron sulfur domain 2 Gene
Size: 2ug
Accessions: BC032300
Gene id: 493856
Gene description: CDGSH iron sulfur domain 2
Synonyms: ERIS; Miner1; NAF-1; WFS2; ZCD2; CDGSH iron-sulfur domain-containing protein 2; endoplasmic reticulum intermembrane small protein; mitoNEET-related 1 protein; nutrient-deprivation autophagy factor-1; zinc finger, CDGSH-type domain 2; CDGSH iron sulfur domain 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgctggagagcgtggcccgtatcgtgaaggtgcagctccctgcatatctgaagcggctcccagtccctgaaagcattaccgggttcgctaggctcacagtttcagaatggcttcggttattgcctttccttggtgtactcgcacttcttggctaccttgcagttcgtccattcctcccgaagaagaaacaacagaaggatagcttgattaatcttaaaatacaaaaggaaaatccgaaagtagtgaatgaaataaacattgaagatttgtgtcttactaaagcagcttattgtaggtgttggcgttctaaaacgtttcctgcctgcgatggttcacataataaacacaatgaattgacaggagataatgtgggtccactaatactgaagaagaaagaagtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - deleted in bladder cancer 1
- TEA domain family member 3
- decapping enzyme, scavenger
- phytanoyl-CoA 2-hydroxylase

Buy CISD2-CDGSH iron sulfur domain 2 Gene now

Add to cart