Cart 53 Product Products 19 207,81 € (empty)
No products
To be determined Shipping
19 207,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 53 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 19 207,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 19 207,81 €
Data sheet of CISD2-CDGSH iron sulfur domain 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CISD2-CDGSH iron sulfur domain 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032300 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CISD2 |
| Origin species: | Human |
| Product name: | CISD2-CDGSH iron sulfur domain 2 Gene |
| Size: | 2ug |
| Accessions: | BC032300 |
| Gene id: | 493856 |
| Gene description: | CDGSH iron sulfur domain 2 |
| Synonyms: | ERIS; Miner1; NAF-1; WFS2; ZCD2; CDGSH iron-sulfur domain-containing protein 2; endoplasmic reticulum intermembrane small protein; mitoNEET-related 1 protein; nutrient-deprivation autophagy factor-1; zinc finger, CDGSH-type domain 2; CDGSH iron sulfur domain 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgctggagagcgtggcccgtatcgtgaaggtgcagctccctgcatatctgaagcggctcccagtccctgaaagcattaccgggttcgctaggctcacagtttcagaatggcttcggttattgcctttccttggtgtactcgcacttcttggctaccttgcagttcgtccattcctcccgaagaagaaacaacagaaggatagcttgattaatcttaaaatacaaaaggaaaatccgaaagtagtgaatgaaataaacattgaagatttgtgtcttactaaagcagcttattgtaggtgttggcgttctaaaacgtttcctgcctgcgatggttcacataataaacacaatgaattgacaggagataatgtgggtccactaatactgaagaagaaagaagtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - deleted in bladder cancer 1 - TEA domain family member 3 - decapping enzyme, scavenger - phytanoyl-CoA 2-hydroxylase |