Login to display prices
Login to display prices
DBC1-deleted in bladder cancer 1 Gene View larger

DBC1-deleted in bladder cancer 1 Gene

PTXBC021560

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DBC1-deleted in bladder cancer 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DBC1-deleted in bladder cancer 1 Gene

Proteogenix catalog: PTXBC021560
Ncbi symbol: DBC1
Product name: DBC1-deleted in bladder cancer 1 Gene
Size: 2ug
Accessions: BC021560
Gene id: 1620
Gene description: deleted in bladder cancer 1
Synonyms: DBC1; DBCCR1; FAM5A; BMP/retinoic acid-inducible neural-specific protein 1; bA574M5.1 (deleted in bladder cancer chromosome region candidate 1 (IB3089A)); bone morphogenetic protein/retinoic acid inducible neural-specific 1; bone morphogenic protein/retinoic acid inducible neural-specific 1; deleted in bladder cancer 1; deleted in bladder cancer chromosome region candidate 1; deleted in bladder cancer protein 1; BMP/retinoic acid inducible neural specific 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactggaggtttgttgagctcctctacttcctgtttatatggggccgtatctcagtgcagccctcccaccaggaaccagctgggacagaccaacatgtctccaaggaatttgattggctcatttcagacagggggcctttccaccactccaggagctacctatcctttgtggaaagacaccgtcaaggatttacaaccagatataaaatatacagggagtttgcccgttggaaggtgaggaacacagccatcgagaggagagatctggtccgccatccagtgcccctcatgccggagtttcaaaggagcatccgcctgcttggcaggagacctaccactcagcagttcatcgataccatcatcaaaaagtacggcacccacctgctcatctcagccacattgggaggggaggaggctttgaccatgtatatggacaaaagtcgcctcgacaggaagtcagggaatgccactcaaagtgttgaagctctgcaccagctcgcatcatcctactttgttgaccgtgatggtaccatgaggaggcttcatgagatccagatatcaactggagcaatcaaggtcacagagacacgcactgggcctctgggctgtaacagttatgacaatctggactctgtgagttccgtccttctgcaaagcacggagagcaaactgcaccttcaaggtcttcagataatctttcctcagtatctgcaagagaagtttgtccagtcggccttgagctatatcatgtgcaatggggagggggagtacctgtgccagaacagccagtgtcgctgccaatgtgccgaggagtttccgcagtgcaactgccccatcacggacatccagatcatggagtacacgctggccaacatggccaagtcttgggccgaagcttataaggacctggagaattcaggtagagagtctcactcagtgccactgcatgagtggccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: