Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DBC1-deleted in bladder cancer 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DBC1-deleted in bladder cancer 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021560 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DBC1 |
| Origin species: | Human |
| Product name: | DBC1-deleted in bladder cancer 1 Gene |
| Size: | 2ug |
| Accessions: | BC021560 |
| Gene id: | 1620 |
| Gene description: | deleted in bladder cancer 1 |
| Synonyms: | DBC1; DBCCR1; FAM5A; BMP/retinoic acid-inducible neural-specific protein 1; bA574M5.1 (deleted in bladder cancer chromosome region candidate 1 (IB3089A)); bone morphogenetic protein/retinoic acid inducible neural-specific 1; bone morphogenic protein/retinoic acid inducible neural-specific 1; deleted in bladder cancer 1; deleted in bladder cancer chromosome region candidate 1; deleted in bladder cancer protein 1; BMP/retinoic acid inducible neural specific 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactggaggtttgttgagctcctctacttcctgtttatatggggccgtatctcagtgcagccctcccaccaggaaccagctgggacagaccaacatgtctccaaggaatttgattggctcatttcagacagggggcctttccaccactccaggagctacctatcctttgtggaaagacaccgtcaaggatttacaaccagatataaaatatacagggagtttgcccgttggaaggtgaggaacacagccatcgagaggagagatctggtccgccatccagtgcccctcatgccggagtttcaaaggagcatccgcctgcttggcaggagacctaccactcagcagttcatcgataccatcatcaaaaagtacggcacccacctgctcatctcagccacattgggaggggaggaggctttgaccatgtatatggacaaaagtcgcctcgacaggaagtcagggaatgccactcaaagtgttgaagctctgcaccagctcgcatcatcctactttgttgaccgtgatggtaccatgaggaggcttcatgagatccagatatcaactggagcaatcaaggtcacagagacacgcactgggcctctgggctgtaacagttatgacaatctggactctgtgagttccgtccttctgcaaagcacggagagcaaactgcaccttcaaggtcttcagataatctttcctcagtatctgcaagagaagtttgtccagtcggccttgagctatatcatgtgcaatggggagggggagtacctgtgccagaacagccagtgtcgctgccaatgtgccgaggagtttccgcagtgcaactgccccatcacggacatccagatcatggagtacacgctggccaacatggccaagtcttgggccgaagcttataaggacctggagaattcaggtagagagtctcactcagtgccactgcatgagtggccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TEA domain family member 3 - decapping enzyme, scavenger - phytanoyl-CoA 2-hydroxylase - RNA binding motif protein 9 |